HPR (NM_020995) Human Untagged Clone
CAT#: SC113071
HPR (untagged)-Human haptoglobin-related protein (HPR)
CNY 5610.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | A-259H10.2; HP |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_020995, the custom clone sequence may differ by one or more nucleotides
ATGAGTGACCTGGGAGCTGTCATTTCCCTCCTGCTCTGGGGACGACAGCTTTTTGCACTGTACTCAGGCA ATGATGTCACGGATATTTCAGATGACCGCTTCCCGAAGCCCCCTGAGATTGCAAATGGCTATGTGGAGCA CTTGTTTCGCTACCAGTGTAAGAACTACTACAGACTGCGCACAGAAGGAGATGGAGTATACACCTTAAAT GATAAGAAGCAGTGGATAAATAAGGCTGTTGGAGATAAACTTCCTGAATGTGAAGCAGTATGTGGGAAGC CCAAGAATCCGGCAAACCCAGTGCAGCGGATCCTGGGTGGACACCTGGATGCCAAAGGCAGCTTTCCCTG GCAGGCTAAGATGGTTTCCCACCATAATCTCACCACAGGGGCCACGCTGATCAATGAACAATGGCTGCTG ACCACGGCTAAAAATCTCTTCCTGAACCATTCAGAAAATGCAACAGCGAAAGACATTGCCCCTACTTTAA CACTCTATGTGGGGAAAAAGCAGCTTGTAGAGATTGAGAAGGTGGTTCTACACCCTAACTACCACCAGGT AGATATTGGGCTCATCAAACTCAAACAGAAGGTGCTTGTTAATGAGAGAGTGATGCCCATCTGCCTACCT TCAAAGAATTATGCAGAAGTAGGGCGTGTGGGTTACGTGTCTGGCTGGGGACAAAGTGACAACTTTAAAC TTACTGACCATCTGAAGTATGTCATGCTGCCTGTGGCTGACCAATACGATTGCATAACGCATTATGAAGG CAGCACATGCCCCAAATGGAAGGCACCGAAGAGCCCTGTAGGGGTGCAGCCCATACTGAACGAACACACC TTCTGTGTCGGCATGTCTAAGTACCAGGAAGACACCTGCTATGGCGATGCGGGCAGTGCCTTTGCCGTTC ACGACCTGGAGGAGGACACCTGGTACGCGGCTGGGATCCTAAGCTTTGATAAGAGCTGTGCTGTGGCTGA GTATGGTGTGTATGTGAAGGTGACTTCCATCCAGCACTGGGTTCAGAAGACCATAGCTGAGAACTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_020995 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | A TrueClone. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020995.3, NP_066275.3 |
| RefSeq Size | 1245 bp |
| RefSeq ORF | 1047 bp |
| Locus ID | 3250 |
| UniProt ID | P00739 |
| Domains | CCP, Tryp_SPc |
| Protein Families | Druggable Genome, Protease, Secreted Protein |
| Gene Summary | This gene encodes a haptoglobin-related protein that binds hemoglobin as efficiently as haptoglobin. Unlike haptoglobin, plasma concentration of this protein is unaffected in patients with sickle cell anemia and extensive intravascular hemolysis, suggesting a difference in binding between haptoglobin-hemoglobin and haptoglobin-related protein-hemoglobin complexes to CD163, the hemoglobin scavenger receptor. This protein may also be a clinically important predictor of recurrence of breast cancer. [provided by RefSeq, Oct 2011] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218300 | HPR (Myc-DDK-tagged)-Human haptoglobin-related protein (HPR) |
CNY 5488.00 |
|
| RC218300L1 | Lenti-ORF clone of HPR (Myc-DDK-tagged)-Human haptoglobin-related protein (HPR) |
CNY 7888.00 |
|
| RC218300L2 | Lenti-ORF clone of HPR (mGFP-tagged)-Human haptoglobin-related protein (HPR) |
CNY 5890.00 |
|
| RC218300L3 | Lenti-ORF clone of HPR (Myc-DDK-tagged)-Human haptoglobin-related protein (HPR) |
CNY 5890.00 |
|
| RC218300L4 | Lenti-ORF clone of HPR (mGFP-tagged)-Human haptoglobin-related protein (HPR) |
CNY 5890.00 |
|
| RG218300 | HPR (tGFP-tagged) - Human haptoglobin-related protein (HPR) |
CNY 4370.00 |
