CYP3A7 (NM_000765) Human Untagged Clone
CAT#: SC110865
CYP3A7 (untagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 7 (CYP3A7)
CNY 5632.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CP37; CYPIIIA7; P-450(HFL33); P-450111A7; P450-HFLA; P450HLp2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_000765, the custom clone sequence may differ by one or more nucleotides
ATGGATCTCATCCCAAACTTGGCCGTGGAAACCTGGCTTCTCCTGGCTGTCAGCCTGATACTCCTCTATC TATATGGAACCCGTACACATGGACTTTTTAAGAAGCTTGGAATTCCAGGGCCCACACCTCTGCCTTTTTT GGGAAATGCTTTGTCCTTCCGTAAGGGCTATTGGACGTTTGACATGGAATGTTATAAAAAGTATAGAAAA GTCTGGGGTATTTATGACTGTCAACAGCCTATGCTGGCTATCACAGATCCCGACATGATCAAAACAGTGC TAGTGAAAGAATGTTATTCTGTCTTCACAAACCGGAGGCCTTTCGGGCCAGTGGGATTTATGAAAAATGC CATCTCTATAGCTGAGGATGAAGAATGGAAGAGAATACGATCATTGCTGTCTCCAACATTCACCAGCGGA AAACTCAAGGAGATGGTCCCTATCATTGCCCAGTATGGAGATGTGTTGGTGAGAAATCTGAGGCGGGAAG CAGAGACAGGCAAGCCTGTCACCTTGAAACACGTCTTTGGGGCCTACAGCATGGATGTGATCACTAGCAC ATCATTTGGAGTGAGCATCGACTCTCTCAACAATCCACAAGACCCCTTTGTGGAAAACACCAAGAAGCTT TTAAGATTTAATCCATTAGATCCATTCGTTCTCTCAATAAAAGTCTTTCCATTCCTTACCCCAATTCTTG AAGCATTAAATATCACTGTGTTTCCAAGAAAAGTTATAAGTTTTCTAACAAAATCTGTAAAACAGATAAA AGAAGGTCGCCTCAAAGAGACACAAAAGCACCGAGTGGATTTCCTTCAGCTGATGATTGACTCTCAGAAT TCAAAAGACTCTGAGACCCACAAAGCTCTGTCTGATCTGGAGCTCATGGCCCAATCAATTATCTTTATTT TTGCTGGCTATGAAACCACGAGCAGTGTTCTCTCCTTCATTATATATGAACTGGCCACTCACCCTGATGT CCAGCAGAAAGTGCAGAAGGAAATTGATACAGTTTTACCCAATAAGGCACCACCCACCTATGATACTGTG CTACAGTTGGAGTATCTTGACATGGTGGTGAATGAAACACTCAGATTATTCCCAGTTGCTATGAGACTTG AGAGGGTCTGCAAAAAAGATGTTGAAATCAATGGGATGTTTATTCCCAAAGGGGTGGTGGTGATGATTCC AAGCTATGTTCTTCATCATGACCCAAAGTACTGGAGAGAGCCTGAGAAGTTCCTCCCTGAAAGGTTCAGT AAAAAGAACAAGGACAACATAGATCCTTACATATACACACCCTTTGGAAGTGGACCCAGAAACTGCATTG GCATGAGGTTTGCTCTCGTGAACATGAAACTTGCTCTAGTCAGAGTCCTTCAGAACTTCTCCTTCAAACC TTGTAAAGAAACACAGATCCCCCTGAAATTACGCTTTGGAGGACTTCTTCTAACAGAAAAACCCATTGTT CTAAAGGCTGAGTCAAGGGATGAGACCGTAAGTGGAGCCTGA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | NotI-NotI |
| ACCN | NM_000765 |
| Insert Size | 2100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000765.2, NP_000756.1 |
| RefSeq Size | 2080 bp |
| RefSeq ORF | 1512 bp |
| Locus ID | 1551 |
| UniProt ID | P24462 |
| Domains | p450 |
| Protein Families | Druggable Genome, P450, Transmembrane |
| Protein Pathways | Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism |
| Gene Summary | This gene encodes a member of the cytochrome P450 superfamily of enzymes, which participate in drug metabolism and the synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. This gene is part of a cluster of related genes on chromosome 7q21.1. Naturally-occurring readthrough transcription occurs between this gene and the downstream CYP3A51P pseudogene and is represented by GeneID:100861540. [provided by RefSeq, Jan 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212353 | CYP3A7 (Myc-DDK-tagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 7 (CYP3A7) |
CNY 5616.00 |
|
| RC212353L3 | Lenti-ORF clone of CYP3A7 (Myc-DDK-tagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 7 (CYP3A7) |
CNY 6460.00 |
|
| RC212353L4 | Lenti-ORF clone of CYP3A7 (mGFP-tagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 7 (CYP3A7) |
CNY 6460.00 |
|
| RG212353 | CYP3A7 (tGFP-tagged) - Human cytochrome P450, family 3, subfamily A, polypeptide 7 (CYP3A7) |
CNY 5040.00 |

