WDR82 (NM_025222) Human Untagged Clone
CAT#: SC110469
WDR82 (untagged)-Human WD repeat domain 82 (WDR82)
CNY 1200.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MST107; MSTP107; PRO2730; PRO34047; SWD2; TMEM113; WDR82A |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_025222, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTGACCGACAGCGTGTTGCGGAGCTTCCGCGTCGCTAAGGTGTTCCGCGAAAACTCGGACAAGA TTAACTGCTTCGATTTCAGCCCCAACGGCGAGACGGTCATCTCGAGTAGCGACGACGACTCCATCGTGCT CTATGACTGCCAGGAGGGCAAACCAAAGAGAACCCTGTACAGTAAGAAATATGGTGTGGACCTCATCAGA TACACTCATGCAGCAAACACAGTTGTTTACAGCTCTAACAAAATAGACGATACTATTCGTTACTTGTCCT TGCATGACAACAAATACATCAGATACTTTCCTGGACATAGCAAAAGGGTGGTGGCCTTGTCCATGTCACC TGTGGATGACACTTTCATTTCTGGGTCTCTTGATAAGACCATTCGACTCTGGGATCTCCGGTCTCCTAAC TGCCAGGGCCTCATGCATCTGCAGGGGAAGCCAGTTTGTTCTTTTGATCCAGAAGGGTTAATTTTCGCTG CAGGTGTCAACTCTGAAATGGTCAAGCTTTATGACCTTCGTTCTTTTGATAAGGGGCCATTTGCTACCTT TAAGATGCAGTATGATCGAACTTGTGAGTGGACAGGACTTAAATTCAGCAATGATGGCAAGCTCATCCTC ATTTCCACCAACGGCAGCTTCATTCGTCTGATTGATGCATTCAAAGGAGTGGTGATGCACACATTTGGGG GTTATGCCAACAGCAAAGCTGTCACACTGGAGGCTTCATTTACTCCAGACTCTCAGTTTATTATGATTGG TTCAGAGGATGGCAAGATCCATGTCTGGAATGGAGAGAGCGGTATAAAAGTAGCTGTGTTGGATGGTAAA CACACAGGCCCGATTACCTGTTTGCAATTCAACCCCAAGTTCATGACTTTTGCCAGTGCGTGTTCCAACA TGGCCTTTTGGTTGCCCACCATTGATGACTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_025222 |
| Insert Size | 1890 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | A TrueClone. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_025222.2, NP_079498.1 |
| RefSeq Size | 4292 bp |
| RefSeq ORF | 414 bp |
| Locus ID | 80335 |
| UniProt ID | Q6UXN9 |
| Gene Summary | TMEM113 (WDR82) is a component of the mammalian SET1A (MIM 611052)/SET1B (MIM 611055) histone H3-Lys4 methyltransferase complexes (Lee and Skalnik, 2005 [PubMed 16253997]; Lee et al., 2007 [PubMed 17355966]).[supplied by OMIM, Jul 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216325 | WDR82 (Myc-DDK-tagged)-Human WD repeat domain 82 (WDR82) |
CNY 2400.00 |
|
| RC216325L3 | Lenti ORF clone of Human WD repeat domain 82 (WDR82), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC216325L4 | Lenti ORF clone of Human WD repeat domain 82 (WDR82), mGFP tagged |
CNY 5890.00 |
|
| RG216325 | WDR82 (tGFP-tagged) - Human WD repeat domain 82 (WDR82) |
CNY 4370.00 |
|
| SC317471 | WDR82 (untagged)-Human WD repeat domain 82 (WDR82) |
CNY 2400.00 |
