SULT1A2 (NM_001054) Human Untagged Clone

CAT#: SC109803

SULT1A2 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1



  "NM_001054" in other vectors (6)

CNY 2400.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
SULT1A2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HAST4; P-PST; P-PST 2; ST1A2; STP2; TSPST2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001054, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGATCCAGGACATCTCTCGCCCGCCACTGGAGTACGTGAAGGGGGTCCCGCTCATCAAGTACT
TTGCAGAGGCACTGGGGCCCCTGCAGAGCTTCCAGGCCCGGCCTGATGACCTGCTCATCAGCACCTACCC
CAAGTCCGGCACCACCTGGGTGAGCCAGATTCTGGACATGATCTACCAGGGCGGTGACCTGGAAAAGTGT
CACCGAGCTCCCATCTTCATGCGGGTGCCCTTCCTTGAGTTCAAAGTCCCAGGGATTCCCTCAGGGATGG
AGACTCTGAAAAACACACCAGCCCCACGACTCCTGAAGACACACCTGCCCCTGGCTCTGCTCCCCCAGAC
TCTGTTGGATCAGAAGGTCAAGGTGGTCTATGTTGCCCGCAACGCAAAGGATGTGGCGGTTTCCTACTAC
CACTTCTACCACATGGCCAAAGTGTACCCTCACCCTGGGACCTGGGAAAGCTTCCTGGAGAAGTTCATGG
CTGGAGAAGTGTCCTATGGGTCCTGGTACCAGCACGTGCAAGAGTGGTGGGAGCTGAGCCGCACCCACCC
TGTTCTCTACCTCTTCTATGAAGACATGAAGGAGAACCCCAAAAGGGAGATTCAAAAGATCCTGGAGTTT
GTGGGGCGCTCCCTGCCAGAGGAGACTGTGGACCTCATGGTTGAGCACACGTCGTTCAAGGAGATGAAGA
AGAACCCTATGACCAACTACACCACCGTCCGCCGGGAGTTCATGGACCACAGCATCTCCCCCTTCATGAG
GAAAGGCATGGCTGGGGACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTAT
GCGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGA


Restriction Sites NotI-NotI     
ACCN NM_001054
Insert Size 5060 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001054.2, NP_001045.1
RefSeq Size 1049 bp
RefSeq ORF 888 bp
Locus ID 6799
UniProt ID P50226
Domains Sulfotransfer
Protein Pathways Sulfur metabolism
Gene Summary Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Two alternatively spliced variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) is the predominant transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...