SULT1A2 (NM_001054) Human Untagged Clone
CAT#: SC109803
SULT1A2 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HAST4; P-PST; P-PST 2; ST1A2; STP2; TSPST2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001054, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGATCCAGGACATCTCTCGCCCGCCACTGGAGTACGTGAAGGGGGTCCCGCTCATCAAGTACT TTGCAGAGGCACTGGGGCCCCTGCAGAGCTTCCAGGCCCGGCCTGATGACCTGCTCATCAGCACCTACCC CAAGTCCGGCACCACCTGGGTGAGCCAGATTCTGGACATGATCTACCAGGGCGGTGACCTGGAAAAGTGT CACCGAGCTCCCATCTTCATGCGGGTGCCCTTCCTTGAGTTCAAAGTCCCAGGGATTCCCTCAGGGATGG AGACTCTGAAAAACACACCAGCCCCACGACTCCTGAAGACACACCTGCCCCTGGCTCTGCTCCCCCAGAC TCTGTTGGATCAGAAGGTCAAGGTGGTCTATGTTGCCCGCAACGCAAAGGATGTGGCGGTTTCCTACTAC CACTTCTACCACATGGCCAAAGTGTACCCTCACCCTGGGACCTGGGAAAGCTTCCTGGAGAAGTTCATGG CTGGAGAAGTGTCCTATGGGTCCTGGTACCAGCACGTGCAAGAGTGGTGGGAGCTGAGCCGCACCCACCC TGTTCTCTACCTCTTCTATGAAGACATGAAGGAGAACCCCAAAAGGGAGATTCAAAAGATCCTGGAGTTT GTGGGGCGCTCCCTGCCAGAGGAGACTGTGGACCTCATGGTTGAGCACACGTCGTTCAAGGAGATGAAGA AGAACCCTATGACCAACTACACCACCGTCCGCCGGGAGTTCATGGACCACAGCATCTCCCCCTTCATGAG GAAAGGCATGGCTGGGGACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTAT GCGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001054 |
| Insert Size | 5060 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001054.2, NP_001045.1 |
| RefSeq Size | 1049 bp |
| RefSeq ORF | 888 bp |
| Locus ID | 6799 |
| UniProt ID | P50226 |
| Domains | Sulfotransfer |
| Protein Pathways | Sulfur metabolism |
| Gene Summary | Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Two alternatively spliced variants that encode the same protein have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) is the predominant transcript. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224689 | SULT1A2 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1 |
CNY 2400.00 |
|
| RC224689L1 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC224689L2 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC224689L3 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224689L4 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG224689 | SULT1A2 (tGFP-tagged) - Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 (SULT1A2), transcript variant 1 |
CNY 4000.00 |
其它SULT1A2产品
