Relaxin 2 (RLN2) (NM_005059) Human Untagged Clone
CAT#: SC109734
RLN2 (untagged)-Human relaxin 2 (RLN2), transcript variant 2
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA12D24.1.1; bA12D24.1.2; H2; H2-RLX; RLXH2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_005059 edited
TGTATGCCTCGCCTGTTTTTTTTCCACCTGCTAGGAGTCTGTTTACTACTGAACCAATTT TCCAGAGCAGTCGCGGACTCATGGATGGAGGAAGTTATTAAATTATGCGGCCGCGAATTA GTTCGCGCGCAGATTGCCATTTGCGGCATGAGCACCTGGAGCAAAAGGTCTCTGAGCCAG GAAGATGCTCCTCAGACACCTAGACCAGTGGCAGGTGATTTTATTCAAACAGTCTCACTG GGAATCTCACCGGACGGAGGGAAAGCACTGAGAACAGGAAGCTGCTTCACCCGAGAGTTC CTTGGTGCCCTTTCCAAATTGTGCCATCCTTCATCAACAAAGATACAGAAACCATAAACT CGAC |
Restriction Sites | Please inquire |
ACCN | NM_005059 |
Insert Size | 400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005059.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005059.2, NP_005050.2 |
RefSeq Size | 889 bp |
RefSeq ORF | 354 bp |
Locus ID | 6019 |
UniProt ID | P04090 |
Domains | IlGF |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the relaxin subfamily and insulin superfamily of peptide hormones. In humans there are three non-allelic relaxin genes. This gene encodes multiple protein isoforms, at least one of which undergoes proteolytic processing. This processing generates relaxin A and B chains that are linked by disulfide bonds to form the mature peptide hormone. This hormone plays a role in the male and female reproductive systems and was initially noted for its role in pregnancy. This protein also plays broader roles in the cardiovascular system, including in the regulation of blood pressure and control of heart rate, and data from animal models shows that this protein may have anti-fibrotic and cardioprotective effects. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) includes an additional alternate exon, resulting in a frameshift in the central and 3' coding regions, compared to variant 1. The encoded isoform (2) is shorter, has a distinct C-terminus and lacks the relaxin A chain compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219807 | RLN2 (Myc-DDK-tagged)-Human relaxin 2 (RLN2), transcript variant 2 |
CNY 1200.00 |
|
RC219807L3 | Lenti-ORF clone of RLN2 (Myc-DDK-tagged)-Human relaxin 2 (RLN2), transcript variant 2 |
CNY 5890.00 |
|
RC219807L4 | Lenti-ORF clone of RLN2 (mGFP-tagged)-Human relaxin 2 (RLN2), transcript variant 2 |
CNY 5890.00 |
|
RG219807 | RLN2 (tGFP-tagged) - Human relaxin 2 (RLN2), transcript variant 2 |
CNY 4370.00 |
其它Relaxin 2产品