OAS1 (NM_002534) Human Untagged Clone

CAT#: SC109505

OAS1 (untagged)-Human 2',5'-oligoadenylate synthetase 1, 40/46kDa (OAS1), transcript variant 2



  "NM_002534" in other vectors (4)

CNY 3656.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
OAS1 Antibody - C-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E18/E16; IFI-4; OIAS; OIASI
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC109505 sequence for NM_002534 edited (data generated by NextGen Sequencing)
ATGATGGATCTCAGAAATACCCCAGCCAAATCTCTGGACAAGTTCATTGAAGACTATCTC
TTGCCAGACACGTGTTTCCGCATGCAAATCAACCATGCCATTGACATCATCTGTGGGTTC
CTGAAGGAAAGGTGCTTCCGAGGTAGCTCCTACCCTGTGTGTGTGTCCAAGGTGGTAAAG
GGTGGCTCCTCAGGCAAGGGCACCACCCTCAGAGGCCGATCTGACGCTGACCTGGTTGTC
TTCCTCAGTCCTCTCACCACTTTTCAGGATCAGTTAAATCGCCGGGGAGAGTTCATCCAG
GAAATTAGGAGACAGCTGGAAGCCTGTCAAAGAGAGAGAGCATTTTCCGTGAAGTTTGAG
GTCCAGGCTCCACGCTGGGGCAACCCCCGTGCGCTCAGCTTCGTACTGAGTTCGCTCCAG
CTCGGGGAGGGGGTGGAGTTCGATGTGCTGCCTGCCTTTGATGCCCTGGGTCAGTTGACT
GGCAGCTATAAACCTAACCCCCAAATCTATGTCAAGCTCATCGAGGAGTGCACCGACCTG
CAGAAAGAGGGCGAGTTCTCCACCTGCTTCACAGAACTACAGAGAGACTTCCTGAAGCAG
CGCCCCACCAAGCTCAAGAGCCTCATCCGCCTAGTCAAGCACTGGTACCAAAATTGTAAG
AAGAAGCTTGGGAAGCTGCCACCTCAGTATGCCCTGGAGCTCCTGACGGTCTATGCTTGG
GAGCGAGGGAGCATGAAAACACATTTCAACACAGCCCAGGGATTTCGGACGGTCTTGGAA
TTAGTCATAAACTACCAGCAACTCTGCATCTACTGGACAAAGTATTATGACTTTAAAAAC
CCCATTATTGAAAAGTACCTGAGAAGGCAGCTCACGAAACCCAGGCCTGTGATCCTGGAC
CCGGCGGACCCTACAGGAAACTTGGGTGGTGGAGACCCAAAGGGTTGGAGGCAGCTGGCA
CAAGAGGCTGAGGCCTGGCTGAATTACCCATGCTTTAAGAATTGGGATGGGTCCCCAGTG
AGCTCCTGGATTCTGCTGGTGAGACCTCCTGCTTCCTCCCTGCCATTCATCCCTGCCCCT
CTCCATGAAGCTTGA

Clone variation with respect to NM_002534.2
484 g=>a
Restriction Sites NotI-NotI     
ACCN NM_002534
Insert Size 1950 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002534.2, NP_002525.2
RefSeq Size 1470 bp
RefSeq ORF 1095 bp
Locus ID 4938
UniProt ID P00973
Protein Families Druggable Genome
Gene Summary This gene is induced by interferons and encodes a protein that synthesizes 2',5'-oligoadenylates (2-5As). This protein activates latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. Alternative splicing results in multiple transcript variants with different enzymatic activities. Polymorphisms in this gene have been associated with susceptibility to viral infection and diabetes mellitus, type 1. A disease-associated allele in a splice acceptor site influences the production of the p46 splice isoform. This gene is located in a cluster of related genes on chromosome 12. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR compared to variant 1. It encodes isoform 2 (also known as E16, p40, or p42), which has a shorter, distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...