LAIR2 (NM_021270) Human Untagged Clone

CAT#: SC109379

LAIR2 (untagged)-Human leukocyte-associated immunoglobulin-like receptor 2 (LAIR2), transcript variant 2



  "NM_021270" in other vectors (4)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Anti-LAIR2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD306
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_021270 edited
CGGGGCCATGTCTCCACACCTCACTGCTCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGAC
CATCCACACGCAGGAGGGGGCCCTTCCCAGACCCTCCATCTCGGCTGAGCCAGGCACTGT
GATCTCCCCGGGGAGCCATGTGACTTTCATGTGCCGGGGCCCGGTTGGGGTTCAAACATT
CCGCCTGGAGAGGGAGGATAGAGCCAAGTACAAAGATAGTTATAATGTGTTTCGACTTGG
TCCATCTGAGTCAGAGGCCAGATTCCACATTGACTCAGTAAGTGAAGGAAATGCCGGGCT
TTATCGCTGCCTCTATTATAAGCCCCCTGGATGGTCTGAGCACAGTGACTTCCTGGAGCT
GCTGGTGAAAGGGACTGTGCCAGGCACTGAAGCCTCCGGATTTGATGCACCATGA
Restriction Sites Please inquire     
ACCN NM_021270
Insert Size 400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021270.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021270.2, NP_067154.1
RefSeq Size 663 bp
RefSeq ORF 408 bp
Locus ID 3904
UniProt ID Q6ISS4
Domains IG
Protein Families Secreted Protein
Gene Summary The protein encoded by this gene is a member of the immunoglobulin superfamily. It was identified by its similarity to leukocyte-associated immunoglobulin-like receptor 1, a membrane-bound receptor that modulates innate immune response. The protein encoded by this locus is a soluble receptor that may play roles in both inhibition of collagen-induced platelet aggregation and vessel formation during placental implantation. This gene maps to a region of 19q13.4, termed the leukocyte receptor cluster, which contains 29 genes in the immunoglobulin superfamily. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1, resulting in an isoform (b) which is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...