PRR16 (NM_016644) Human Untagged Clone
CAT＃: SC108605
PRR16 (untagged)-Human proline rich 16 (PRR16)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DSC54; LARGEN |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_016644, the custom clone sequence may differ by one or more nucleotides
ATGGCACAATCTGGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGCTATTCTCCTGCCTCAGCCTGCCT CAGTGCGCCACTACGCCTGGGTGGTTGACCAGATTGACACCCTGACCTCTGACCTACAGCTGGAGGATGA GATGACTGACAGCTCCAAAACGGACACGCTGAATAGTAGCTCAAGTGGCACAACAGCCTCCAGCCTAGAG AAGATCAAAGTGCAGGCTAATGCACCGCTTATTAAACCCCCAGCACACCCATCTGCTATCCTCACGGTCC TGAGAAAGCCAAACCCTCCACCACCTCCTCCAAGGTTGACACCTGTGAAGTGTGAAGACCCCAAAAGGGT GGTTCCAACTGCCAATCCTGTAAAAACCAATGGCACCCTTCTACGAAATGGAGGCTTACCAGGTGGACCT AACAAAATTCCAAATGGAGATATCTGCTGCATACCCAACAGTAACTTGGACAAGGCTCCAGTCCAGCTTC TGATGCATAGACCTGAAAAAGACAGATGTCCCCAGGCAGGGCCTCGAGAACGAGTTCGGTTTAATGAAAA AGTACAGTACCATGGCTATTGTCCTGACTGTGATACCCGGTATAACATAAAAAACAGGGAGGTCCACTTA CACAGTGAACCTGTCCACCCACCGGGAAAGATTCCTCACCAAGGCCCTCCCCTCCCTCCTACACCCCATC TCCCTCCTTTCCCACTAGAAAATGGGGGAATGGGAATAAGCCACAGTAACAGCTTCCCCCCTATCAGACC TGCAACTGTGCCTCCTCCCACTGCACCAAAACCACAGAAGACGATCTTGAGGAAGTCAACCACTACAACC GTGTGA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | NotI-NotI |
| ACCN | NM_016644 |
| Insert Size | 1950 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_016644.1, NP_057728.1 |
| RefSeq Size | 1798 bp |
| RefSeq ORF | 846 bp |
| Locus ID | 51334 |
| UniProt ID | Q569H4 |
| Gene Summary | Regulator of cell size that promotes cell size increase independently of mTOR and Hippo signaling pathways. Acts by stimulating the translation of specific mRNAs, including those encoding proteins affecting mitochondrial functions. Increases mitochondrial mass and respiration.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an additional exon in the 5' region, and it thus differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216256 | PRR16 (Myc-DDK-tagged)-Human proline rich 16 (PRR16) |
CNY 3600.00 |
|
| RC216256L3 | Lenti ORF clone of Human proline rich 16 (PRR16), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC216256L4 | Lenti ORF clone of Human proline rich 16 (PRR16), mGFP tagged |
CNY 5890.00 |
|
| RG216256 | PRR16 (tGFP-tagged) - Human proline rich 16 (PRR16) |
CNY 5200.00 |
