LYPD6B (NM_177964) Human Untagged Clone
CAT#: SC107028
LYPD6B (untagged)-Human LY6/PLAUR domain containing 6B (LYPD6B)
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT116; LYPD7 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_177964 edited
ATGTTGCTGATTACTCTGAGTGCAAACCTTTTCACTGTTCCAGAGAGGAGCCTGACAACC ACATTCTCCTTCTCAAGATATAAGAGTTCGGACCGCCCAGCACACAAGGTCAGCATGCTG CTCCTCTGTCACGCTCTCGCTATAGCTGTTGTCCAGATCGTTATCTTCTCAGAAAGCTGG GCATTTGCCAAGAACATCAACTTCTATAATGTGAGGCCTCCTCTCGACCCTACACCATTT CCAAATAGCTTCAAGTGCTTTACTTGTGAAAACGCAGGGGATAATTATAACTGCAATCGA TGGGCAGAAGACAAATGGTGTCCACAAAATACACAGTACTGTTTGACAGTTCATCACTTC ACCAGCCACGGAAGAAGCACATCCATCACCAAAAAGTGTGCCTCCAGAAGTGAATGTCAT TTTGTCGGTTGCCACCACAGCCGAGATTCTGAACATACGGAGTGTAGGTCTTGCTGTGAA GGAATGATCTGCAATGTAGAATTACCCACCAATCACACTAATGCAGTGTTTGCCGTAATG CACGCTCAGAGAACATCTGGCAGCAGTGCCCCCACACTCTACCTACCAGTGCTTGCCTGG GTCTTTGTGCTTCCATTGCTGTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_177964 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_177964.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_177964.3, NP_808879.2 |
RefSeq Size | 1600 bp |
RefSeq ORF | 624 bp |
Locus ID | 130576 |
UniProt ID | Q8NI32 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Believed to act as a modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro acts on nAChRs in a subtype- and stoichiometry-dependent manner. Modulates specifically alpha-3(3):beta-4(2) nAChRs by enhancing the sensitivity to ACh, decreasing ACh-induced maximal current response and increasing the rate of desensitization to ACh; has no effect on alpha-7 homomeric nAChRs; modulates alpha-3(2):alpha-5:beta-4(2) nAChRs in the context of CHRNA5/alpha-5 variant Asn-398 but not its wild-type sequence.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207249 | LYPD6B (Myc-DDK-tagged)-Human LY6/PLAUR domain containing 6B (LYPD6B) |
CNY 2400.00 |
|
RC207249L3 | Lenti ORF clone of Human LY6/PLAUR domain containing 6B (LYPD6B), Myc-DDK-tagged |
CNY 5890.00 |
|
RC207249L4 | Lenti ORF clone of Human LY6/PLAUR domain containing 6B (LYPD6B), mGFP tagged |
CNY 5890.00 |
|
RG207249 | LYPD6B (tGFP-tagged) - Human LY6/PLAUR domain containing 6B (LYPD6B) |
CNY 4370.00 |