Axin 2 (AXIN2) (BC006295) Human Untagged Clone

CAT#: SC106135

AXIN2 (untagged)-Homo sapiens, Similar to axin 2 (conductin, axil), clone MGC:10366 IMAGE:4053244, complete cds



CNY 4750.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal AXIN2 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AXIL; axin 2; conductin; DKFZp781B0869; MGC10366; MGC126582
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC106135 representing BC006295.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTAGCGCTATGTTGGTGACTTGCCTCCCGGACCCCAGCAGCAGCTTCCGTGAGGATGCCCCGCGG
CCCCCAGTGCCAGGGGAAGAAGGGGAGACCCCACCGTGTCAGCCAGGGGTGGGCAAGGGCCAGGTCACC
AAACCCATGCCTGTCTCTTCCAACACCAGGCGGAACGAAGATGGGTTGGGGGAGCCGGAGGGGCGGGCA
TCTCCGGATTCCCCTCTGACCCGGTGGACCAAGTCCTTACACTCCTTATTGGGCGATCAAGACGGTGCT
TACCTGTTCCGAACTTTCCTGGAGAGGGAGAAATGCGTGGATACCTTAGACTTCTGGTTTGCCTGCAAT
GGATTCAGGCAGATGAACCTGAAGGATACCAAAACTTTACGAGTAGCCAATGACTTTTGTCATGACATT
TTGTTCTACTTATACTGTAAATTATGCATTATAAAGAGTTCATTTAAGGAAAATTACTTGGTACAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC006295
Insert Size 483 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC006295.2
RefSeq Size 1041 bp
RefSeq ORF 483 bp
Locus ID 8313
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Induced pluripotent stem cells
Protein Pathways Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Pathways in cancer, Wnt signaling pathway
MW 18 kDa
Gene Summary The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...