BEX2 (NM_032621) Human Untagged Clone

CAT#: SC104136

BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3



  "NM_032621" in other vectors (5)

CNY 2950.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


BEX2 mouse monoclonal antibody,clone OTI1D1
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BEX1; DJ79P11.1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_032621 edited
CCCGGTGTCCCTGAGGACGTGCGGGCCAGGTACGGCCCCGAAAGTAGGAAGCGGAGGGGG
AGCAGGTTTGCGGGGCCAAGTGTTGCGGCGACGCACCTCACGTCGAGAATCGGGAGGAGG
AGACTGCAAGGATAGGCCCAGGAGTAATGGAGTCCAAAGAGGAACGAGCGTTAAACAATC
TCATCGTGGAAAATGTCAACCAGGAAAATGATGAAAAAGATGAAAAGGAGCAAGTTGCTA
ATAAAGGGGAGCCCTTGGCCCTACCTTTGAATGTTAGTGAATACTGTGTGCCTAGAGGAA
ACCGTAGGCGGTTCCGCGTTAGGCAGCCCATCCTGCAGTATAGATGGGACATAATGCATA
GGCTTGGAGAGCCACAGGCAAGGATGAGAGAGGAGAATATGGAAAGGATTGGGGAGGAGG
TGAGACAGCTGATGGAAAAGCTGAGGGAAAAGCAGTTGAGTCATAGTTTGCGGGCAGTCA
GCACTGATCCCCCTCACCATGACCATCACGATGAGTTTTGCCTTATGCCCTGAATCCTGA
TGGTTTCCCTGAAGTTAATAGGGAGACCCCTGCTTCCTAAACTTACACATTTGTGGTGTA
CCTTTGTCGTAAACGTTTTGATGTTACCTATTTCTTGTGGGTCTCCTATTACCAGCTTCT
AAATGAATGTTGTTTTTGACCCAGTTTGTAAGTTTCTGTCAGCAGGAGAGTTTTACCTAT
TGCATGGAAAGATGCTCATTATATATTGTGAAGTTAATAAAACAGTTTTAAAAAGCAAAA
AAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_032621
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_032621.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_032621.2, NP_116010.1
RefSeq Size 878 bp
RefSeq ORF 387 bp
Locus ID 84707
UniProt ID Q9BXY8
Domains BEX
Gene Summary This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3 and 4 encode the same isoform (3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...