DOK6 (NM_152721) Human Untagged Clone
CAT＃: SC100498
DOK6 (untagged)-Human docking protein 6 (DOK6)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DOK5L; HsT3226 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_152721, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCCAACTTTAACGACATAGTCAAGCAGGGCTACGTGAAAATCCGCAGCAGGAAGCTTGGGATTT TCAGACGATGCTGGTTGGTTTTCAAGAAGGCTTCTAGCAAAGGACCCAGAAGGTTAGAAAAATTTCCAGA TGAAAAGGCAGCTTATTTCAGAAACTTTCATAAGGTAACTGAACTGCACAATATCAAAAATATAACCAGA CTGCCCCGAGAGACAAAGAAGCATGCGGTGGCAATCATCTTTCACGATGAAACATCGAAGACATTTGCCT GTGAGTCAGAGCTGGAGGCCGAGGAGTGGTGCAAGCACCTCTGCATGGAGTGTCTGGGGACCAGGCTCAA TGATATCAGCCTTGGGGAGCCCGACCTTCTGGCCGCAGGAGTGCAGCGGGAACAGAATGAGAGATTCAAC GTGTATCTTATGCCTACACCAAACCTGGATATTTATGGTGAATGCACAATGCAGATCACTCATGAAAATA TCTATCTCTGGGATATCCACAATGCCAAGGTCAAACTGGTGATGTGGCCTCTCAGCTCACTGAGGAGATA CGGTCGGGACTCAACGTGGTTCACGTTTGAGTCAGGAAGAATGTGTGACACAGGAGAAGGACTATTCACT TTTCAAACAAGGGAAGGAGAAATGATCTATCAGAAGGTTCATTCTGCGACACTGGCCATAGCTGAGCAAC ATGAAAGATTAATGCTAGAAATGGAACAGAAGGCCCGGCTTCAGACAAGCTTGACTGAACCAATGACATT ATCCAAATCAATATCTCTTCCTCGCAGCGCGTACTGGCATCACATCACTCGTCAGAACAGCGTTGGTGAA ATCTACAGTTTGCAAGGTCATGGGTTTGGTTCGTCAAAGATGTCTCGTGCACAGACATTTCCCAGCTACG CCCCAGAACAGAGTGAAGAGGCCCAGCAGCCGTTGTCGCGGTCCAGCAGCTATGGATTCAGCTACAGCTC CAGCCTCATCCAATGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_152721 |
| Insert Size | 1120 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_152721.2, NP_689934.2 |
| RefSeq Size | 1965 bp |
| RefSeq ORF | 996 bp |
| Locus ID | 220164 |
| UniProt ID | Q6PKX4 |
| Domains | IRS |
| Protein Families | Druggable Genome |
| Gene Summary | DOK6 is a member of the DOK (see DOK1; MIM 602919) family of intracellular adaptors that play a role in the RET (MIM 164761) signaling cascade (Crowder et al., 2004 [PubMed 15286081]).[supplied by OMIM, Mar 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210487 | DOK6 (Myc-DDK-tagged)-Human docking protein 6 (DOK6) |
CNY 2400.00 |
|
| RC210487L3 | Lenti ORF clone of Human docking protein 6 (DOK6), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC210487L4 | Lenti ORF clone of Human docking protein 6 (DOK6), mGFP tagged |
CNY 5890.00 |
|
| RG210487 | DOK6 (tGFP-tagged) - Human docking protein 6 (DOK6) |
CNY 4000.00 |
