DOK6 (NM_152721) Human Untagged Clone

CAT#: SC100498

DOK6 (untagged)-Human docking protein 6 (DOK6)



  "NM_152721" in other vectors (4)

CNY 2400.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DOK6 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DOK5L; HsT3226
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_152721, the custom clone sequence may differ by one or more nucleotides


ATGGCCTCCAACTTTAACGACATAGTCAAGCAGGGCTACGTGAAAATCCGCAGCAGGAAGCTTGGGATTT
TCAGACGATGCTGGTTGGTTTTCAAGAAGGCTTCTAGCAAAGGACCCAGAAGGTTAGAAAAATTTCCAGA
TGAAAAGGCAGCTTATTTCAGAAACTTTCATAAGGTAACTGAACTGCACAATATCAAAAATATAACCAGA
CTGCCCCGAGAGACAAAGAAGCATGCGGTGGCAATCATCTTTCACGATGAAACATCGAAGACATTTGCCT
GTGAGTCAGAGCTGGAGGCCGAGGAGTGGTGCAAGCACCTCTGCATGGAGTGTCTGGGGACCAGGCTCAA
TGATATCAGCCTTGGGGAGCCCGACCTTCTGGCCGCAGGAGTGCAGCGGGAACAGAATGAGAGATTCAAC
GTGTATCTTATGCCTACACCAAACCTGGATATTTATGGTGAATGCACAATGCAGATCACTCATGAAAATA
TCTATCTCTGGGATATCCACAATGCCAAGGTCAAACTGGTGATGTGGCCTCTCAGCTCACTGAGGAGATA
CGGTCGGGACTCAACGTGGTTCACGTTTGAGTCAGGAAGAATGTGTGACACAGGAGAAGGACTATTCACT
TTTCAAACAAGGGAAGGAGAAATGATCTATCAGAAGGTTCATTCTGCGACACTGGCCATAGCTGAGCAAC
ATGAAAGATTAATGCTAGAAATGGAACAGAAGGCCCGGCTTCAGACAAGCTTGACTGAACCAATGACATT
ATCCAAATCAATATCTCTTCCTCGCAGCGCGTACTGGCATCACATCACTCGTCAGAACAGCGTTGGTGAA
ATCTACAGTTTGCAAGGTCATGGGTTTGGTTCGTCAAAGATGTCTCGTGCACAGACATTTCCCAGCTACG
CCCCAGAACAGAGTGAAGAGGCCCAGCAGCCGTTGTCGCGGTCCAGCAGCTATGGATTCAGCTACAGCTC
CAGCCTCATCCAATGA


Restriction Sites NotI-NotI     
ACCN NM_152721
Insert Size 1120 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_152721.2, NP_689934.2
RefSeq Size 1965 bp
RefSeq ORF 996 bp
Locus ID 220164
UniProt ID Q6PKX4
Domains IRS
Protein Families Druggable Genome
Gene Summary DOK6 is a member of the DOK (see DOK1; MIM 602919) family of intracellular adaptors that play a role in the RET (MIM 164761) signaling cascade (Crowder et al., 2004 [PubMed 15286081]).[supplied by OMIM, Mar 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...