Cidec (NM_001244798) Rat Untagged Clone

CAT#: RN216115

Cidec (untagged) - Rat cell death-inducing DFFA-like effector c (Cidec), transcript variant 3



  "NM_001244798" in other vectors (1)

CNY 2380.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216115 representing NM_001244798
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTATGCTATGAAGTCTCTCAGCCTTCTCTACCCTAGGTCACTGTCCAGGCATGTAGCAGTGAGCA
CTGCAGTGGTGACCCAACAGCTGGTGTCTGAGCCCAGCCGGGAGACCCCCAGGGCAAGACCCTGTCGTGT
TAGCACCGCAGATCGGAAGGTTCGCAAAGGCATCATGGCCCACAGCTTGGAGGACCTCCTGGGCAAGGTC
CAAGACATCTTGAAGCTTAAAGACAAGCCCTTCTCCCTGGTGTTGGAGGAAGATGGCACAATCGTGGAGA
CAGAAGAATACTTCCAAGCCCTACCAAGAGATACAGTGTTCATGGTCCTGCAGAAGGGGCAGAAGTGGAA
GTCCCCATCAGAACAGCGCAAGAAGAAAGCCCAGCTATCCCTTTCCCAGAAGCCAACTAAGAAGATCGAC
GTGGCCCGGGTAACCTTTGACCTGTACAAGCTGAACCCTCAGGACTTCATCGGCTGCCTGAACGTGAAGG
CAACCCTCTATGACACATACTCGCTTTCATATGACCTGCACTGCTACAGGGCCAAACGCATCGTGAAGGA
AATGCTCCGCTGGACTCTCTTCAGTATGCAAGCCACAGGCCACATGCTGCTTGGCACCTCCAGTTACATG
CAGCAGTTCCTGGATGCCACTGAGGAAGAACAGCCCTCCAAGGCCAAGGCCTCCCTCCTCCCTGCCTGTC
TGAAGATGCTGCAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001244798
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244798.1, NP_001231727.1
RefSeq Size 1655 bp
RefSeq ORF 717 bp
Locus ID 500292
UniProt ID Q5XI33
Gene Summary Binds to lipid droplets and regulates their enlargement, thereby restricting lipolysis and favoring storage. At focal contact sites between lipid droplets, promotes directional net neutral lipid transfer from the smaller to larger lipid droplets. The transfer direction may be driven by the internal pressure difference between the contacting lipid droplet pair. Its role in neutral lipid transfer and lipid droplet enlargement is activated by the interaction with PLIN1. May act as a CEBPB coactivator in the white adipose tissue to control the expression of a subset of CEBPB downstream target genes, including SOCS1, SOCS3, TGFB1, TGFBR1, ID2 and XDH. When overexpressed in preadipocytes, induces apoptosis or increases cell susceptibility to apoptosis induced by serum deprivation or TGFB treatment. The physiological significance of its role in apoptosis is unclear (By similarity). May play a role in the modulation of the response to osmotic stress by preventing NFAT5 to translocate into the nucleus and activate its target genes expression.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' exon, which results in a downstream AUG start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...