Snap25 (NM_001270576) Rat Untagged Clone

CAT#: RN216043

Snap25 (untagged) - Rat synaptosomal-associated protein 25 (Snap25), transcript variant 2



  "NM_001270576" in other vectors (1)

CNY 2,090.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Anti-SNAP25 Antibody
    • 100 ul

CNY 5,643.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms SNAP-25a; SNAP-25B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216043 representing NM_001270576
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGAGGACGCAGACATGCGTAATGAACTGGAGGAGATGCAGAGGAGGGCTGACCAGCTGGCTGATG
AGTCCCTGGAAAGCACCCGTCGCATGCTGCAGCTGGTCGAAGAGAGTAAAGATGCTGGCATCAGGACTTT
GGTTATGTTGGATGAGCAAGGCGAACAACTCGATCGTGTCGAAGAAGGCATGAACCATATCAACCAAGAC
ATGAAGGAGGCCGAGAAAAATTTAAAAGATTTAGGCAAATGCTGTGGCCTTTTCATATGTCCTTGTAACA
AGCTTAAATCCAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGATGGAGTAGTGGCCAGCCAGCC
TGCCCGTGTGGTGGATGAACGGGAGCAGATGGCCATCAGTGGTGGCTTCATCCGCAGGGTAACAAACGAT
GCCCGGGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGAAACCTCCGTCATATGG
CCCTAGACATGGGCAATGAGATTGACACCCAGAATCGCCAGATTGACAGGATCATGGAGAAGGCTGACTC
CAACAAAACCAGAATTGATGAAGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270576
Insert Size 621 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270576.1, NP_001257505.1
RefSeq Size 2047 bp
RefSeq ORF 621 bp
Locus ID 25012
UniProt ID P60881
Gene Summary Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein. It is essential for regulated exocytosis in neuronal cells. Alternative transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) has an alternate 5' UTR exon, compared to variant 1. Both variants 1 and 2 encode the same isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...