Snf8 (NM_001007804) Rat Untagged Clone

CAT#: RN215304

Snf8 (untagged ORF) - Rat SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) (Snf8), (10 ug)



  "NM_001007804" in other vectors (3)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Snf8 Antibody - N-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms D11moh34; RGD1310144
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215304 representing NM_001007804
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCACCGGCGCGGGGTGGGAGCTGGCGCCATTGCCAAGAAGAAACTCGCCGAGGCCAAGTATAAGGAGC
GAGGGACTGTCTTGGCTGAGGACCAGCTGGCTCAGATGTCAAAACAGTTGGACATGTTCAAGACCAACCT
AGAAGAATTTGCCAGCAAGCACAAGCAAGAGATCCGGAAGAATCCTGAGTTCCGAGTTCAGTTCCAGGAC
ATGTGTGCTACCATTGGGGTGGATCCTCTGGCCTCTGGAAAAGGATTTTGGTCTGAGATGCTGGGTGTTG
GGGACTTCTATTATGAACTGGGCGTCCAGATTATTGAAGTGTGCCTGGCCCTAAAACATCGGAACGGAGG
TCTGATAACTCTGGAGGAGCTACATCAGCAGGTGTTAAAAGGAAGGGGCAAGTTTGCTCAGGATGTCAGC
CAAGACGACCTGATCAGGGCCATCAAGAAGCTGAAAGCACTGGGCACTGGATTTGGCATCATCCCTGTGG
GAGGAACTTACCTCATTCAGTCTGTTCCAGCTGAGCTCAATATGGATCACACTGTTGTGCTGCAGCTGGC
CGAGAAAAACGGTTATGTGACTGTCAGTGAAATCAAAGCCAGTCTTAAATGGGAGACGGAGCGAGCACGG
CAAGTGCTGGAACACCTGCTGAAGGAAGGACTGGCCTGGCTGGATCTGCAGGCACCAGGGGAGGCCCACT
ACTGGCTGCCAGCTCTCTTCACAGATCTCTACTCCCAGGAGATATCAGCTGAGGAGGCCAAAGAAGTCTT
TCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001007804
Insert Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007804.1, NP_001007805.1
RefSeq Size 777 bp
RefSeq ORF 777 bp
Locus ID 287645
UniProt ID Q5RK19
Gene Summary Required for degradation of both endocytosed EGF and EGFR, but not for the EGFR ligand-mediated internalization (By similarity). Component of the endosomal sorting complex required for transport II (ESCRT-II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs. The MVB pathway mediates delivery of transmembrane proteins into the lumen of the lysosome for degradation. The ESCRT-II complex is probably involved in the recruitment of the ESCRT-III complex. The ESCRT-II complex may also play a role in transcription regulation by participating in derepression of transcription by RNA polymerase II, possibly via its interaction with ELL.Required for the exosomal release of SDCBP, CD63 and syndecan (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...