Fxyd7 (NM_022008) Rat Untagged Clone
CAT#: RN215122
Fxyd7 (untagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN215122 representing NM_022008
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCACCCCAACCCAGAGCCCCACAAACGTTCCTGAAGAAACAGATCCTTTTTTCTATGACTATGCCA CCGTGCAGACTGTGGGGATGACCCTGGCCACTATCATGTTCGTGCTGGGCATCATCATCATCATCAGCAA GAAGGTTAAGTGCAGGAAGGCGGACTCCAGGTCTGAGAGCCCAACATGCAAATCCTGTAAGTCGGAACTG CCCTCCTCAGCCCCTGGAGGTGGCGGTGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022008 |
Insert Size | 243 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022008.1, NP_071291.1 |
RefSeq Size | 714 bp |
RefSeq ORF | 243 bp |
Locus ID | 63848 |
UniProt ID | P59649 |
Gene Summary | This reference sequence was derived from multiple ESTs and validated by similar mouse cDNA and human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, FXYD7, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR215122 | Fxyd7 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug) |
CNY 3990.00 |
|
RR215122L3 | Lenti ORF clone of Fxyd7 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug) |
CNY 6080.00 |
|
RR215122L4 | Lenti ORF clone of Fxyd7 (mGFP-tagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug) |
CNY 6650.00 |