Zdhhc3 (NM_001039014) Rat Untagged Clone
CAT#: RN214516
Zdhhc3 (untagged ORF) - Rat zinc finger, DHHC-type containing 3 (Zdhhc3), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN214516 representing NM_001039014
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGCTTATCCCCACTCATCACTTCCGAGACATTGAACGGAAACCAGAATACCTCCAGCCAGAGAAGT GTGCCCCACCTCCCTTCCCTGGCCCCGTGGGAACCATGTGGTTTATCCGCGATGGCTGTGGCATCGCCTG TGCCATTGTCACCTGGTTTCTGGTCCTCTATGCAGAGTTTGTAGTCCTCTTTGTCATGCTGATTCCATCC CGAGACTACGCATACAGTATCATCAACGGAATTGTGTTCAACCTGCTGGCCTTCTTGGCTCTGGCCTCCC ACTGCCGGGCCATGCTGACGGACCCCGGGGCAGTGCCCAAAGGAAATGCCACTAAAGAGTTCATCGAGAG CCTTCAGCTGAAGCCTGGGCAGGTGGTGTACAAGTGTCCCAAGTGCTGCAGCATCAAGCCCGACCGGGCA CACCACTGCAGTGTTTGTAAGCGGTGCATTCGCAAGATGGACCACCACTGTCCTTGGGTCAACAACTGTG TCGGCGAGAACAACCAGAAGTACTTTGTCCTGTTCACAATGTACATAGCTCTCATTTCCTTGCACGCCCT CATCATGGTGGGATTCCACTTCCTGCATTGCTTTGAAGAAGACTGGACAAAGTGCAGCTCCTTCTCACCG CCCACCACTGTTATCCTGCTCATCCTGCTGTGTTTTGAGGCCCTGCTCTTCCTCATTTTCACATCAGTGA TGTTTGGGACCCAAGTGCACTCCATCTGCACAGATGAGACGGGAATAGAACAATTGAAAAAGGAAGAGAG AAGATGGGCTAAAAAAACAAAGTGGATGAACATGAAAGCCGTTTTTGGCCACCCTTTCTCTTTAGGCTGG GCCAGCCCCTTTGCCACACCAGACCAAGGGAAGGCAGACCCGTACCAGTATGTGGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039014 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001039014.1, NP_001034103.1 |
RefSeq Size | 1880 bp |
RefSeq ORF | 900 bp |
Locus ID | 301081 |
UniProt ID | Q2TGK3 |
Gene Summary | Golgi-localized palmitoyltransferase that catalyzes the addition of palmitate onto various protein substrates. Has no stringent fatty acid selectivity and in addition to palmitate can also transfer onto target proteins myristate from tetradecanoyl-CoA and stearate from octadecanoyl-CoA (By similarity). Plays an important role in G protein-coupled receptor signaling pathways involving GNAQ and potentially other heterotrimeric G proteins by regulating their dynamic association with the plasma membrane (By similarity). Palmitoylates ITGA6 and ITGB4, thereby regulating the alpha-6/beta-4 integrin localization, expression and function in cell adhesion to laminin (By similarity). Plays a role in the TRAIL-activated apoptotic signaling pathway most probably through the palmitoylation and localization to the plasma membrane of TNFRSF10A (By similarity). In the brain, by palmitoylating the gamma subunit GABRG2 of GABA(A) receptors and regulating their postsynaptic accumulation, plays a role in synaptic GABAergic inhibitory function and GABAergic innervation. Palmitoylates the neuronal protein GAP43 which is also involved in the formation of GABAergic synapses. Palmitoylates NCDN thereby regulating its association with endosome membranes. Probably palmitoylates PRCD and is involved in its proper localization within the photoreceptor. Could mediate the palmitoylation of NCAM1 and regulate neurite outgrowth. Could palmitoylate DNAJC5 and regulate its localization to Golgi membranes (By similarity). Also constitutively palmitoylates DLG4 (PubMed:19596852). May also palmitoylate SNAP25. Could palmitoylate the glutamate receptors GRIA1 and GRIA2 but this has not been confirmed in vivo (By similarity). Could also palmitoylate the D(2) dopamine receptor DRD2.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR214516 | Zdhhc3 (Myc-DDK-tagged ORF) - Rat zinc finger, DHHC-type containing 3 (Zdhhc3), (10 ug) |
CNY 3990.00 |
|
RR214516L3 | Lenti ORF clone of Zdhhc3 (Myc-DDK-tagged ORF) - Rat zinc finger, DHHC-type containing 3 (Zdhhc3), (10 ug) |
CNY 6080.00 |
|
RR214516L4 | Lenti ORF clone of Zdhhc3 (mGFP-tagged ORF) - Rat zinc finger, DHHC-type containing 3 (Zdhhc3), (10 ug) |
CNY 6650.00 |