Ciapin1 (NM_001007689) Rat Untagged Clone

CAT#: RN214471

Ciapin1 (untagged ORF) - Rat cytokine induced apoptosis inhibitor 1 (Ciapin1), (10 ug)



  "NM_001007689" in other vectors (3)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MGC94686
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214471 representing NM_001007689
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGAGTTTGGGATCTCCCCTGGCCAGCTTGTGGCAGTGTTCTGTGACAAGTCATCTTCTGAAGAGG
CCCTTAAAAAACTGGTGGGTAGAGTTCAAGGATTAACTGGCAGCGAGGGCCAAGTATTCGTGGAAAACAT
CACCCAGCTGTTGCAGTCTGCCCATAAGGAATCCAGCTTCGATGTCATTCTGTCCGGTATAGTCCCAGGA
AGCACCTCTCTGCACAGTCCTGAGGCTCTGGCTGACATGGCCCGGATCCTCCGGCCAGGGGGGTGTCTTT
TTCTGAAAGAACCAGTGGAGACAACTGGAGTTAACAATGACAAAATAAAGACAGCCTCTAAGCTGTGTTC
AGCCCTGACTCTTTCTGGCCTTGTGGAAATAAAAGAGTTGCAGCGGGAGGCCTTAAGCCCTGAGGAGGCG
CAGTCCATGCAGGAGCACCTGGGCTACCACAGTGACAGCCTGCTCTCAGTCCACGTCACAGGCAAGAAGC
CAAACTTTGAAGTGGGTTCTTCTAGCCAGCTAAAGCTTCTCCACAAGAAGTCGTCTTCAGTGAAGCCTGT
TGTGGATCCTGCTACTGCCAAGCTCTGGACCCTCTCAGCCAATGACATGGAGGATGACAGCATGGATCTC
ATTGACTCAGATGAGCTGCTAGATCCAGAAGATTTGAAGAAGCCTGATCCAGCCTCTCTGAAGGCGCCTT
CATGTGGGGAAGGGAAAAAGAGGAAGGCCTGTAAGAACTGCACCTGTGGCCTGGCAGAGGAACTGGAGAA
AGAGCAGTCCAAGGCGCAGAGCTCTCAGCCCAAGTCAGCCTGTGGAAATTGCTACCTGGGAGATGCTTTC
CGATGTGCCAACTGCCCCTACCTTGGGATGCCAGCCTTCAAGCCTGGAGAGCAGGTCCTCCTGAGCAGTA
GCAACCTCCAGGATGCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001007689
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007689.1, NP_001007690.1
RefSeq Size 1806 bp
RefSeq ORF 930 bp
Locus ID 307649
UniProt ID Q5XID1
Gene Summary Component of the cytosolic iron-sulfur (Fe-S) protein assembly (CIA) machinery required for the maturation of extramitochondrial Fe-S proteins. Part of an electron transfer chain functioning in an early step of cytosolic Fe-S biogenesis, facilitating the de novo assembly of a [4Fe-4S] cluster on the scaffold complex NUBP1-NUBP2. Electrons are transferred to CIAPIN1 from NADPH via the FAD- and FMN-containing protein NDOR1. NDOR1-CIAPIN1 are also required for the assembly of the diferric tyrosyl radical cofactor of ribonucleotide reductase (RNR), probably by providing electrons for reduction during radical cofactor maturation in the catalytic small subunit. Has anti-apoptotic effects in the cell. Involved in negative control of cell death upon cytokine withdrawal. Promotes development of hematopoietic cells.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...