Tdp2 (NM_001034947) Rat Untagged Clone

CAT#: RN214106

Tdp2 (untagged ORF) - Rat Traf and Tnf receptor associated protein (Ttrap), (10 ug)



  "NM_001034947" in other vectors (3)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Ttrap
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214106 representing NM_001034947
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCTGGCAGCAGTTCCGATGCGGCGGAGTCGGCAGAGCCGGCGGCGGCGCCCGCAGCAGCAGAGA
CGGAGGAGGATCAGGTGAAGAGGCGGCGGCTTCAGTCCCTGGGATTTGCGTTGGTGACGAGCTGCGACAC
TACGGTGGCTTCCACTTTCCTGTCGGAGAACAACTGGCAGACGAAAAAAGCGTTGAGCGCCTTCTTCGAG
CAGCCAGAGAACGACCTAGCGCGGCCTCACCAGCCTCCGACATCCTCCAAGTCCGAGGACTATGTTGATC
TAACCAATGAGGATGCAAATGATACCACCATTTTAGAAACCAGTCCATCTGGAACTCCTCTAGAAGATAG
CAGCACTATCTCTTTCATTACCTGGAATATTGATGGATTAGATGGATGCAATCTCCCAGAGAGGGCTCGA
GGGGTGTGTTCCTGCCTTGCTTTGTACAGTCCGGACGTGGTATTTCTACAGGAAGTGATTCCCTCCTACT
GTGCCTACCTAAGGAAGAGAGCACGCACTTACAACATTATTACAGGTAATGAAGAAGGATATTTCACAGC
TATATTATTGAAGAAAGGAAGAGTGAAATTTAAAGGTCAAGAAATTATTCCTTTTCCAAATACCAAAATG
ATGAGAAACCTTCTGTGTGTAAATGTGAGTTTGGGTGGAAATGAATTTTGCCTTATGACATCCCATTTGG
AGAGCACAAGAAAACATTCTGCTGAACGAATAAATCAATTAAAAACTGTTTTTCAAAAAATGCAAGAGGC
TACAGATTCAACTACTGTTATATTTGCAGGAGATACAAATTTAAGAGATCAAGAAGTTATCAAATGTGGT
GGTTTACCTGACAATGTTTTTGATGCCTGGGAATTTTTGGGCAAACCTAAGCATTGCCGGTATACATGGG
ATACGAAAGCAAACGATAATCTCAGGATTCCTGCCGCTTGTAAGCATCGTTTTGATCGAATATTCTTCAG
AGCAGAAGAGGGACACCTTATTCCCCAAAGTTTAGACCTAATTGGGTTGGAAAGACTGGACTGTGGTAGA
TTTCCTAGTGATCACTGGGGGCTCCTGTGTACCTTGAATGTAGTATTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001034947
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001034947.1, NP_001030119.1
RefSeq Size 1966 bp
RefSeq ORF 1101 bp
Locus ID 498749
UniProt ID Q3T1H5
Gene Summary DNA repair enzyme that can remove a variety of covalent adducts from DNA through hydrolysis of a 5'-phosphodiester bond, giving rise to DNA with a free 5' phosphate. Catalyzes the hydrolysis of dead-end complexes between DNA and the topoisomerase 2 (TOP2) active site tyrosine residue. The 5'-tyrosyl DNA phosphodiesterase activity can enable the repair of TOP2-induced DNA double-strand breaks/DSBs without the need for nuclease activity, creating a 'clean' DSB with 5'-phosphate termini that are ready for ligation. Thereby, protects the transcription of many genes involved in neurological development and maintenance from the abortive activity of TOP2. Hydrolyzes 5'-phosphoglycolates on protruding 5' ends on DSBs due to DNA damage by radiation and free radicals. Has preference for single-stranded DNA or duplex DNA with a 4 base pair overhang as substrate. Has also 3'-tyrosyl DNA phosphodiesterase activity, but less efficiently and much slower than TDP1. Constitutes the major if not only 5'-tyrosyl-DNA phosphodiesterase in cells. Also acts as an adapter by participating in the specific activation of MAP3K7/TAK1 in response to TGF-beta: associates with components of the TGF-beta receptor-TRAF6-TAK1 signaling module and promotes their ubiquitination dependent complex formation. Involved in non-canonical TGF-beta induced signaling routes. May also act as a negative regulator of ETS1 and may inhibit NF-kappa-B activation. Acts as a regulator of ribosome biogenesis following stress.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...