Bdh2 (NM_001106473) Rat Untagged Clone
CAT#: RN213039
Bdh2 (untagged ORF) - Rat 3-hydroxybutyrate dehydrogenase, type 2 (Bdh2), (10 ug)
CNY 3990.00
Cited in 4 publications. |
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Dhrs6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN213039 representing NM_001106473
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTTTGGATTGCACTGCAGGATCCACCATGGGCCGCCTGGAAGGGAAAGTCATCGTCCTGACAGCTG CCGCTCAAGGGATCGGCCGGGCTTCTGCTTTAGCTTTCGCAAGAGAAGGAGCCAAAGTCATAGCCACAGA TATCAACGAGGCCAAACTCCAGGAGCTGGAAAATTACCCAGGTATTCAAACTCGAGTCCTTGATGTCACA AAGAAGAGACAAATTGATCAGTTCGCCTCAGAAATTGAGAAGATTGATGTTCTCTTTAACGTTGCTGGTT TTGTCCACCACGGAACCATCCTGGATTGCGAGGAAAAAGACTGGGACTTCTCCATGAATCTCAACGTCCG CAGCATGTACCTGATGATCAAGGCATTCCTGCCCAAAATGCTTGCTCAGAAATCTGGCAACATTATCAAC ATGTCTTCCGTGGCCTCCAGCATCAAAGGGGTGGAGAACAGATGTGTGTACAGTGCAACCAAGGCAGCTG TGATCGGCCTCACCAAGTCCGTGGCTGCAGACTTCATCCAGCAGGGCATCAGATGCAACTGTGTGTGCCC AGGAACGGTTGACACCCCATCTCTGCAAGAAAGAATACAAGCCAGAGATGATCCCAAAGAGGCACTGAAA GCTTTCCTAAACAGACAGAAGACCGGAAGGTTTGCATCTGCAGAAGAGGTCGCCCTGCTCTGCGTATACT TGGCCTCAGATGAGTCAGCCTATGTGACTGGCACCCCTGTCGTCATCGATGGCGGTTGGAGTCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001106473 |
Insert Size | 768 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001106473.1, NP_001099943.1 |
RefSeq Size | 1156 bp |
RefSeq ORF | 768 bp |
Locus ID | 295458 |
UniProt ID | D4A1J4 |
Gene Summary | Dehydrogenase that mediates the formation of 2,5-dihydroxybenzoic acid (2,5-DHBA), a siderophore that shares structural similarities with bacterial enterobactin and associates with LCN2, thereby playing a key role in iron assimilation and homeostasis. Plays a role in susceptibility to bacterial infection by providing an assimilable source of iron that is exploited by pathogenic bacteria (By similarity). Also acts as a 3-hydroxybutyrate dehydrogenase (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (4)
The use of this cDNA Clones has been cited in the following citations: |
---|
Inactivation of 3-hydroxybutyrate dehydrogenase type 2 promotes proliferation and metastasis of nasopharyngeal carcinoma by iron retention
,null,
British Journal of Cancer
,PubMed ID 31819181
[Bdh2]
|
Dysregulation of Ketone Body Metabolism Is Associated With Poor Prognosis for Clear Cell Renal Cell Carcinoma Patients
,null,
Frontiers in Oncology
,PubMed ID 31921677
[Bdh2]
|
Inflammation and ER Stress Downregulate BDH2 Expression and Dysregulate Intracellular Iron in Macrophages
,null,
Journal of Immunology Research
,PubMed ID 25762501
[Bdh2]
|
Siderophore-mediated iron trafficking in humans is regulated by iron
,null,
Journal of molecular medicine (Berlin, Germany)
,PubMed ID 22527885
[Bdh2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR213039 | Bdh2 (Myc-DDK-tagged ORF) - Rat 3-hydroxybutyrate dehydrogenase, type 2 (Bdh2), (10 ug) |
CNY 3990.00 |
|
RR213039L3 | Lenti ORF clone of Bdh2 (Myc-DDK-tagged ORF) - Rat 3-hydroxybutyrate dehydrogenase, type 2 (Bdh2), (10 ug) |
CNY 6080.00 |
|
RR213039L4 | Lenti ORF clone of Bdh2 (mGFP-tagged ORF) - Rat 3-hydroxybutyrate dehydrogenase, type 2 (Bdh2), (10 ug) |
CNY 6650.00 |