Sh2d1a (NM_001109313) Rat Untagged Clone

CAT#: RN211676

Sh2d1a (untagged ORF) - Rat SH2 domain protein 1A (Sh2d1a), (10 ug)



  "NM_001109313" in other vectors (3)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms RGD1562408
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211676 representing NM_001109313
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGCGGTGACTGTGTACCACGGCAAAATCAGCAGGGAGATGGGGGAGAAGCTCTTACTCGCTACGG
GGCTGGATGGAAGCTATCTGCTGCGAGACAGCGAGAGTGTCCCTGGCGTGTACTGCCTGTGTGTTTTGTA
TCAAGGTTACATCTATACGTATCGAGTGTCCCAGACAGAAACAGGCTCTTGGAGTGCTGAGACAGCACCT
GGGGTACATAAAAGATTTTTCCGGAAAGTAAAAAATCTCATTTCAGCATTTCAGAAGCCAGATCAAGGCA
TCGTAACGCCTCTGCAGTATCCAGTTGAAAAGTCCTCGGCTAGGAGTCCACAAGCTCCCACAGGGAGAAG
AGATTCTGATATCTGCTTGAAAGCGCCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001109313
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001109313.2, NP_001102783.2
RefSeq Size 1236 bp
RefSeq ORF 381 bp
Locus ID 501502
UniProt ID B2RZ59
Gene Summary Cytoplasmic adapter regulating receptors of the signaling lymphocytic activation molecule (SLAM) family such as SLAMF1, CD244, LY9, CD84, SLAMF6 and SLAMF7. In SLAM signaling seems to cooperate with SH2D1B/EAT-2. Initially it has been proposed that association with SLAMF1 prevents SLAMF1 binding to inhibitory effectors including INPP5D/SHIP1 and PTPN11/SHP-2. However, by simultaneous interactions, recruits FYN which subsequently phosphorylates and activates SLAMF1. Positively regulates CD244/2B4- and CD84-mediated natural killer (NK) cell functions. Can also promote CD48-, SLAMF6 -, LY9-, and SLAMF7-mediated NK cell activation. In the context of NK cell-mediated cytotoxicity enhances conjugate formation with target cells (By similarity). May also regulate the activity of the neurotrophin receptors NTRK1, NTRK2 and NTRK3 (PubMed:16223723).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...