Tiprl (NM_001109667) Rat Untagged Clone

CAT#: RN211522

Tiprl (untagged ORF) - Rat TIP41, TOR signaling pathway regulator-like (S. cerevisiae) (Tiprl), (10 ug)



  "NM_001109667" in other vectors (3)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms RGD1310442
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211522 representing NM_001109667
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGATCCACGGCTTTCAGAGCAGCCACCAGGACTTCTCCTTCGGGCCTTGGAAGCTTACCGCGTCCA
AGACCCACATCATGAAGTCTGCGGATGTGGAAAAGTTAGCCGACGAGCTGCATATGCCATCCCTCCCTGA
AATGATGTTTGGAGACAACGTTCTAAGGATCCAGCATGGTTCTGGCTTCGGAATAGAGTTCAATGCTACG
GATGCCCTGAGATGTGTGAACAACTACCAGGGCATGCTCAAAGTAGCCTGTGCTGAAGAGTGGCAGGAAA
GTAGGACGGAGGGTGAACACTCCAAAGAAGTTATTAAACCATATGACTGGACCTATACAACAGATTATAA
AGGAACGTTGCTTGGAGAATCTCTTAAGTTAAAGGTTGTACCTACAACAGATCATATAGATACAGAAAAA
TTGAAAGCCAGAGAGCAGATTAAATTTTTTGAAGAAGTTCTCCTGTTTGAAGATGAATTACATGATCATG
GCGTTTCCAGCCTGAGTGTGAAAATTAGAGTAATGCCTTCCAGCTTTTTTCTGCTATTGCGGTTTTTCCT
GAGAATTGATGGGGTGCTCATCAGAATGAATGACACAAGGCTTTATCATGAGGCTGACAAGACCTACATG
TTACGAGAATATACATCCAGAGAGAGCAAAATTGCTAATTTAATGCATGTTCCACCTTCCCTCTTCACGG
AACCTAATGAAATATCACAATATTTACCAATTAAGGAAGCAGTTTGTGAGAAGCTAGTATTTCCAGAAAG
AATTGATCCTAACCCCGTGGACTCAGAAAGTGCGCCCTCAGAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001109667
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001109667.1, NP_001103137.1
RefSeq Size 1726 bp
RefSeq ORF 816 bp
Locus ID 360869
UniProt ID A2VCX1
Gene Summary May be a allosteric regulator of serine/threonine-protein phosphatase 2A (PP2A). Inhibits catalytic activity of the PP2A(D) core complex in vitro. The PP2A(C):TIPRL complex does not show phosphatase activity. Acts as negative regulator of serine/threonine-protein phosphatase 4 probably by inhibiting the formation of the active PPP4C:PPP4R2 complex; the function is proposed to implicate it in DNA damage response by promoting H2AFX phosphorylated on Ser-140 (gamma-H2AFX). May play a role in the regulation of ATM/ATR signaling pathway controlling DNA replication and repair (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...