Zdhhc2 (NM_145096) Rat Untagged Clone

CAT#: RN210878

Zdhhc2 (untagged ORF) - Rat zinc finger, DHHC-type containing 2 (Zdhhc2), (10 ug)



  "NM_145096" in other vectors (3)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms DHHC2; srec
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210878 representing NM_145096
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCCCTCGGGCCCCGGTGGCGTGAGGCGGCGGTGCCGGCGGGTGCTCTACTGGATCCCTGTGGTGT
TCATCAGCTTGCTTCTGGGCTGGTGCTACTATGCTTACGCGATCCAGCTGTGCATAGTGTCCATGGAAAA
CATTGGTGAACAAGTTGTGTGCCTCATGGCTTATCATCTACTTTTCGCAATGTTTGTCTGGTCATACTGG
AAAACCATTTTTACATTGCCCATGAATCCTTCAAAAGAATTCCATCTCTCTTATGCAGAGAAAGAATTGC
TGGAGAGAGAGCCAAGAGGAGAAGCCCATCAGGAAGTTCTGAGGCGAGCAGCCAAAGACCTTCCCATCTA
CACCAGGACCATGTCCGGCGCGATCCGATATTGTGACAGATGCCGACTTATAAAGCCAGACCGCTGCCAT
CACTGTTCCGTCTGTGATAAATGTATTTTGAAGATGGACCATCATTGCCCATGGGTGAACAATTGTGTTG
GATTTTCAAATTATAAATTCTTCCTCCTTTTCTTGGCTTACTCTCTGCTGTACTGCCTTTTCATTGCTGC
TACAGATTTACAGTATTTTATCAGATTTTGGACAAATGGTCTCCCTGATACTCAAGCCAAGTTCCATATT
ATGTTTTTATTCTTTGCTGCAGCTATGTTTTCTGTCAGCTTGTCCTCTCTTTTTGGTTATCATTGCTGGC
TAGTCAGCAAAAATAAATCTACATTAGAGGCATTCAGAAATCCAGTATTTAGACATGGAACAGATAAGAA
CGGATTCAGCTTGGGTTTCAGTAAAAACATGCGACAAGTTTTTGGCGATGAGAAGAAGTATTGGCTGTTA
CCAATATTTTCAAGTCAAGGTGATGGCTGTTCCTTTCCAACTTGCCTTGTTAACCAGGATCCTGAACAAC
CTTCCACTCCTGCAGGACTAAATTCAACAGCGAAAAATCCTGAAAACCATCAGTTTCCTGCAAAGCCGTT
GAGAGAGTCACAGAGCCACCTCCTTACGGATTCTCAGACCTGGACAGAGAACAGTTCAAACTCCGGGAGA
TGCAAAGCCGGTATGAGCAACCCTGCATTAACTATGGAGAACGAGACTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_145096
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145096.2, NP_659564.2
RefSeq Size 1735 bp
RefSeq ORF 1101 bp
Locus ID 246326
Gene Summary Palmitoyltransferase that catalyzes the addition of palmitate onto various protein substrates and is involved in a variety of cellular processes (PubMed:19596852, PubMed:21343290, PubMed:25589740). Has no stringent fatty acid selectivity and in addition to palmitate can also transfer onto target proteins myristate from tetradecanoyl-CoA and stearate from octadecanoyl-CoA (By similarity). In the nervous system, plays a role in long term synaptic potentiation by palmitoylating AKAP5 through which it regulates protein trafficking from the dendritic recycling endosomes to the plasma membrane and controls both structural and functional plasticity at excitatory synapses (PubMed:25589740). In dendrites, mediates the palmitoylation of DLG4 when synaptic activity decreases and induces synaptic clustering of DLG4 and associated AMPA-type glutamate receptors (PubMed:19596852). Also mediates the de novo and turnover palmitoylation of RGS7BP, a shuttle for Gi/o-specific GTPase-activating proteins/GAPs, promoting its localization to the plasma membrane in response to the activation of G protein-coupled receptors. Through the localization of these GTPase-activating proteins/GAPs, it also probably plays a role in G protein-coupled receptors signaling in neurons (PubMed:21343290). Also probably plays a role in cell adhesion by palmitoylating CD9 and CD151 to regulate their expression and function. Palmitoylates the endoplasmic reticulum protein CKAP4 and regulates its localization to the plasma membrane. Could also palmitoylate LCK and regulate its localization to the plasma membrane (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...