Gpx1 (NM_030826) Rat Untagged Clone

CAT#: RN210732

Gpx1 (untagged ORF) - Rat glutathione peroxidase 1 (Gpx1), (Note, selenocysteine protein, internal stop codon, see reference data summary)



  "NM_030826" in other vectors (1)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Synonyms GSHPx; GSHPx-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210732 representing NM_030826
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGCTGCTCGGCTCTCCGCGGTGGCACAGTCCACCGTGTATGCCTTCTCCGCGCGCCCGCTGGCGG
GCGGGGAGCCCGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGAATGTCGCGTCCCTCTG
AGGCACCACGACCCGGGACTACACCGAAATGAATGATCTGCAGAAGCGTCTGGGGCCTCGTGGCCTGGTG
GTGCTCGGTTTCCCGTGCAATCAGTTCGGACATCAGGAGAATGGCAAGAATGAAGAGATTCTGAATTCCC
TCAAGTATGTCCGACCCGGTGGTGGGTTCGAGCCCAACTTTACATTGTTTGAGAAGTGCGAGGTGAATGG
TGAGAAGGCTCACCCGCTCTTTACCTTCCTGCGGAATGCCTTGCCAGCACCCAGTGACGATCCCACTGCG
CTCATGACCGACCCCAAGTACATCATTTGGTCCCCGGTGTGCCGCAACGACATTTCCTGGAACTTTGAGA
AGTTCCTGGTAGGTCCAGACGGTGTTCCAGTGCGCAGATACAGCAGGCGCTTTCGCACCATCGACATCGA
ACCCGATATAGAAGCCCTGCTGTCCAAGCAGCCTAGCAACCCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_030826
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_030826.3, NP_110453.3
RefSeq Size 898 bp
RefSeq ORF 606 bp
Locus ID 24404
UniProt ID P04041
Gene Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Jul 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...