Sln (NM_001013247) Rat Untagged Clone
CAT＃: RN209680
Sln (untagged ORF) - Rat sarcolipin (Sln), (10 ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN209680 representing NM_001013247
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCGGTCTACCCAGGAGCTGTTTATCAACTTCACAGTTGTCCTGATCACTGTGCTCCTCATGTGGC TCCTCGTGAGGTCCTACCAATACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001013247 |
| Insert Size | 96 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001013247.1, NP_001013265.1 |
| RefSeq Size | 298 bp |
| RefSeq ORF | 96 bp |
| Locus ID | 367086 |
| UniProt ID | Q6SLE7 |
| Gene Summary | Reversibly inhibits the activity of ATP2A1 in sarcoplasmic reticulum by decreasing the apparent affinity of the ATPase for Ca(2+). Modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. Required for muscle-based, non-shivering thermogenesis (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR209680 | Sln (Myc-DDK-tagged ORF) - Rat sarcolipin (Sln), (10 ug) |
CNY 3990.00 |
|
| RR209680L3 | Lenti ORF clone of Sln (Myc-DDK-tagged ORF) - Rat sarcolipin (Sln), (10 ug) |
CNY 6080.00 |
|
| RR209680L4 | Lenti ORF clone of Sln (mGFP-tagged ORF) - Rat sarcolipin (Sln), (10 ug) |
CNY 6650.00 |
