Xpa (NM_001106656) Rat Untagged Clone

CAT#: RN207399

Xpa (untagged ORF) - Rat xeroderma pigmentosum, complementation group A (Xpa), (10 ug)



  "NM_001106656" in other vectors (3)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207399 representing NM_001106656
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACAGCGGAGGAGAAGCGGACGTCACCGGAGCCCGCGGCCGCGGAGAAGCCCGCGGAGCTGCCGG
CCGCCGTACGCGCGAGCGTGGAGCGGAAGCGGCAGCGGGCGCTGATGCTGCGCCAGGCCCGGCTGGCGGC
GCGGCCGTACCCGGCGGCGGCGGCCACCGGAGGCGTGACCAGCATAAAAGCAGCTCCCAAAGTGATTGAC
ACCAAAGGTGGCTTCATTTTAGAAGAGGAGGAAGAAGAGAAACACAAGATTGGAGATGTTGTTCATGAAC
CAGGGCCCGTCATGGAGTTTGATTACACCATCTGTGAAGAGTGTGGGAAAGAGTTCATGGACTCGTATCT
TATGAACCACTTCGATTTGCCAACATGCGATAGCTGCAGAGATGCTGATGATAAACACAAGCTTATAACC
AAAACAGAAGCCAAGCAAGAATACCTTCTGAAGGACTGTGATTTAGAGAAAAGAGAGCCAGCGCTCAGGT
TCATTGTGAAGAAGAACCCTCGCCATTCACAGTGGGGCGATATGAAGCTCTACTTAAAGCTACAGGTTGT
AAAGCGGGCTCTTGAAGTTTGGGGTAGCCAGGAAGCTCTGGAAGATGCAAAGGAAGTGAGGCAGGAAAAC
CGAGAAAAAATGAAGCAGAAGAAGTTTGATAAAAAAGTAAAAGTAGGATTTTATGATGCAATGAAGATTC
TCCTCTATGACAAACCTCTCTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001106656
Insert Size 726 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001106656.1, NP_001100126.1
RefSeq Size 1204 bp
RefSeq ORF 726 bp
Locus ID 298074
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...