Atg12 (NM_001038495) Rat Untagged Clone

CAT#: RN205679

Atg12 (untagged ORF) - Rat ATG12 autophagy related 12 homolog (S. cerevisiae) (Atg12), (10 ug)



  "NM_001038495" in other vectors (3)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Atg12 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Apg12l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN205679 representing NM_001038495
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAAGACCCAGAGGCTGTGCTGCAGCTCCCCGCGGCTCCGGCTGCTGCGGCGGGCGAGAGCCTTT
TGGAGCTCTCCCCAGAAACAGCCATCCCAGAGCCCCCGTCTTCGGTTGCAGTTTCGCCCGGTACGGAGGA
ACCTCCCGGAGACACCAAGAAAAAAATTGACATCCTGCTGAAGGCTGTAGGAGACACTCCCATAATGAAA
ACGAAGAAATGGGCTGTGGAGCGGACCCGGACTGTCCAAGCACTCATCGACTTCATCAGAAAATTCCTCA
GACTGCTGGCCTCGGAGCAGTTGTTTATTTATGTGAATCAGTCCTTTGCCCCTTCCCCAGACCAAGAAGT
TGGGACTCTATATGAGTGTTTTGGCAGTGATGGTAAACTGGTCCTACATTACTGCAAATCACAGGCATGG
GGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001038495
Insert Size 426 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001038495.1, NP_001033584.1
RefSeq Size 2590 bp
RefSeq ORF 426 bp
Locus ID 361321
UniProt ID Q2TBJ5
Gene Summary Ubiquitin-like protein involved in autophagy vesicles formation. Conjugation with ATG5 through a ubiquitin-like conjugating system involving also ATG7 as an E1-like activating enzyme and ATG10 as an E2-like conjugating enzyme, is essential for its function. The ATG12-ATG5 conjugate acts as an E3-like enzyme which is required for lipidation of ATG8 family proteins and their association to the vesicle membranes. The ATG12-ATG5 conjugate also regulates negatively the innate antiviral immune response by blocking the type I IFN production pathway through direct association with RARRES3 and MAVS. Plays also a role in translation or delivery of incoming viral RNA to the translation apparatus (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...