Atg3 (NM_134394) Rat Untagged Clone

CAT#: RN204962

Atg3 (untagged ORF) - Rat ATG3 autophagy related 3 homolog (S. cerevisiae) (Atg3), (10 ug)



  "NM_134394" in other vectors (3)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Apg3l; PIG-1; Pig1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204962 representing NM_134394
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGAATGTGATCAACACGGTGAAGGGAAAGGCTCTGGAAGTGGCCGAGTACCTGACCCCGGTCCTCA
AGGAATCAAAATTTAAGGAAACAGGTGTAATCACCCCAGAAGAGTTTGTGGCAGCTGGAGATCACTTAGT
CCACCACTGTCCAACATGGCAATGGGCTACAGGGGAAGAATTGAAAGTGAAGGCATATCTACCAACAGGG
AAACAGTTTTTGGTAACCAAAAATGTTCCATGCTACAAGCGGTGTAAACAGATGGAGTATTCGGATGAAT
TGGAGGCTATCATTGAAGAAGATGATGGTGATGGGGGCTGGGTAGACACGTACCATAACACAGGTATTAC
AGGAATTACTGAAGCAGTTAAGGAGATTACACTGGAAAGCAAGGACAGTATAAAACTCCAAGACTGCTCA
GTGCTGTGCGATGAAGAGGAGGAGGAAGAGGAAGGGGAAGCTGCAGACATGGAAGAATATGAAGAGAGTG
GATTGTTGGAAACAGATGAGGCTACCCTAGACACCAGAAGAATAGTGGAAGCTTGTAAAGCTAAAGCTGA
TGCTGGGGGTGAAGACGCCATTCTGCAAACAAGAACCTATGACCTGTACATCACTTACGACAAGTACTAC
CAGACGCCACGGCTCTGGCTGTTTGGCTATGATGAGCAACGGCAGCCTTTAACAGTTGAGCACATGTATG
AAGACATCAGTCAAGATCATGTGAAGAAAACAGTGACCATTGAAAACCATCCTCACCTCCCACCACCTCT
TATGTGTTCAGTTCACCCCTGCAGGCATGCTGAAGTGATGAAGAAAATTATTGAGACCGTTGCAGAAGGC
GGGGGAGAGCTTGGTGTTCATATGTATCTTTTAATTTTTTTGAAATTTGTTCAAGCTGTCATTCCAACAA
TAGAATATGACTACACAAGACACTTCACAATGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_134394
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_134394.2, NP_599221.1
RefSeq Size 1423 bp
RefSeq ORF 945 bp
Locus ID 171415
UniProt ID Q6AZ50
Gene Summary E2 conjugating enzyme required for the cytoplasm to vacuole transport (Cvt), autophagy, and mitochondrial homeostasis. Responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8-like proteins (GABARAP, GABARAPL1, GABARAPL2 or MAP1LC3A). The ATG12-ATG5 conjugate plays a role of an E3 and promotes the transfer of ATG8-like proteins from ATG3 to phosphatidylethanolamine (PE). This step is required for the membrane association of ATG8-like proteins. The formation of the ATG8-phosphatidylethanolamine conjugates is essential for autophagy and for the cytoplasm to vacuole transport (Cvt). Preferred substrate is MAP1LC3A. Also acts as an autocatalytic E2-like enzyme, catalyzing the conjugation of ATG12 to itself, ATG12 conjugation to ATG3 playing a role in mitochondrial homeostasis but not in autophagy. ATG7 (E1-like enzyme) facilitates this reaction by forming an E1-E2 complex with ATG3 (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...