Pea15 (NM_001013231) Rat Untagged Clone
CAT＃: RN204927
Pea15 (untagged ORF) - Rat phosphoprotein enriched in astrocytes 15A (Pea15a), (10 ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | Pea15a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN204927 representing NM_001013231
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGAGTACGGGACTCTCCTTCAGGACCTGACCAACAACATCACCCTTGAAGATCTGGAACAGCTCA AGTCAGCCTGCAAGGAGGACATCCCCAGTGAGAAGAGTGAAGAGATCACTACAGGCAGTGCCTGGTTTAG CTTCCTGGAGAGCCACAACAAGCTGGACAAAGACAACCTCTCCTACATTGAGCACATCTTTGAGATCTCC CGCCGTCCTGACCTACTCACGATGGTGGTTGACTACAGAACCCGTGTGCTGAAGATCTCTGAGGAGGATG AGCTGGACACCAAGCTAACCCGTATCCCCAGCGCCAAGAAGTACAAAGACATTATCCGGCAGCCCTCTGA GGAAGAAATCATCAAATTGGCTCCCCCACCAAAGAAGGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001013231 |
| Insert Size | 393 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001013231.1, NP_001013249.1 |
| RefSeq Size | 2355 bp |
| RefSeq ORF | 393 bp |
| Locus ID | 364052 |
| UniProt ID | Q5U318 |
| Gene Summary | Blocks Ras-mediated inhibition of integrin activation and modulates the ERK MAP kinase cascade. Inhibits RPS6KA3 activities by retaining it in the cytoplasm. Inhibits both TNFRSF6- and TNFRSF1A-mediated CASP8 activity and apoptosis. Regulates glucose transport by controlling both the content of SLC2A1 glucose transporters on the plasma membrane and the insulin-dependent trafficking of SLC2A4 from the cell interior to the surface (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR204927 | Pea15 (Myc-DDK-tagged ORF) - Rat phosphoprotein enriched in astrocytes 15A (Pea15a), (10 ug) |
CNY 3990.00 |
|
| RR204927L3 | Lenti ORF clone of Pea15 (Myc-DDK-tagged ORF) - Rat phosphoprotein enriched in astrocytes 15A (Pea15a), (10 ug) |
CNY 6080.00 |
|
| RR204927L4 | Lenti ORF clone of Pea15 (mGFP-tagged ORF) - Rat phosphoprotein enriched in astrocytes 15A (Pea15a), (10 ug) |
CNY 6650.00 |
