Dppa3 (NM_001047864) Rat Untagged Clone
CAT#: RN204825
Dppa3 (untagged ORF) - Rat developmental pluripotency-associated 3 (Dppa3), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN204825 representing NM_001047864
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGAGCCATCCGAGAAAGTCGACCCAGTCGTGAACCCAGAAACTCAGATGTATGATGGATCTCAGA GGGAAGATGAAGGGGACTCACCGGATGATTCAGAAATCCTACAACCAGAAACACTAGTAAAGGTCATGAA AAAGCTAACCCTGAACCCCAGTGCCAAGCCGACAAAATATCATCGTCGTCAAAGGGTTCGTCTCCAGGTT AAGAGCCAGCCTGTGGAGAACAGAAGTGAAAGAATCATGAGGGAAGTTCAAAGCGCCTTTCCCAGGAGAA GGGTCCGCACTCTGTTGTCCGTGCTGAAAGACCCCATAGCAAGGATGAGAAGATTTGTTCGGATTGAGCA GAGACAAAGACAGCTTGAAGGAAATGAGAGACGAGATGAGCCATTCAGATGTCTCTGCACTTTCTGCCAT TATCAGAGATGGGATCCTTCTGAGAATGCTAAAATCGGGCAGAACCAGAAGAATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001047864 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001047864.1, NP_001041329.1 |
RefSeq Size | 708 bp |
RefSeq ORF | 477 bp |
Locus ID | 297576 |
UniProt ID | Q6IMK0 |
Gene Summary | Primordial germ cell (PGCs)-specific protein involved in epigenetic chromatin reprogramming in the zygote following fertilization. In zygotes, DNA demethylation occurs selectively in the paternal pronucleus before the first cell division, while the adjacent maternal pronucleus and certain paternally-imprinted loci are protected from this process. Participates in protection of DNA methylation in the maternal pronucleus by preventing conversion of 5mC to 5hmC: specifically recognizes and binds histone H3 dimethylated at 'Lys-9' (H3K9me2) on maternal genome, and protects maternal genome from TET3-mediated conversion to 5hmC and subsequent DNA demethylation. Does not bind paternal chromatin, which is mainly packed into protamine and does not contain much H3K9me2 mark. Also protects imprinted loci that are marked with H3K9me2 in mature sperm from DNA demethylation in early embryogenesis. May be important for the totipotent/pluripotent states continuing through preimplantation development. Also involved in chromatin condensation in oocytogenesis (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR204825 | Dppa3 (Myc-DDK-tagged ORF) - Rat developmental pluripotency-associated 3 (Dppa3), (10 ug) |
CNY 3990.00 |
|
RR204825L3 | Lenti ORF clone of Dppa3 (Myc-DDK-tagged ORF) - Rat developmental pluripotency-associated 3 (Dppa3), (10 ug) |
CNY 6080.00 |
|
RR204825L4 | Lenti ORF clone of Dppa3 (mGFP-tagged ORF) - Rat developmental pluripotency-associated 3 (Dppa3), (10 ug) |
CNY 6650.00 |