Ifi30 (NM_001030026) Rat Untagged Clone

CAT#: RN204298

Ifi30 (untagged ORF) - Rat interferon gamma inducible protein 30 (Ifi30), (10 ug)



  "NM_001030026" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MGC124690
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204298 representing NM_001030026
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTGTTCTCCGCTCGTACCATTCTTGTCCCTTTTGCTTCTGCTGTTCCTACCCGAGGTTCCCAGAG
CAGCCACTGCGTCCCTGCCGCAAGGATCCTCCGAGGGCGCAGCCACCTGCAAGGCCCACGACCTGTGCCT
CTTCGGGCCACGCCGGTTGCTCTCTGCACCACCTGTCAATGTCAGCCTCTATTATGAGTCCCTGTGTGGA
GCTTGTCGCTACTTCCTCGTCCGAAATTTGTTCCCAACCTGGCTGATGGTTATGGAAATCATGAACATCA
CTCTGGTGCCCTACGGGAACGCACAGGAGAGAAATGTCAGCGGTACATGGGAGTTCACGTGCCAGCACGG
GGAGCTGGAGTGTAAACTGAACAAGGTGGAGGCCTGTCTGCTGGACAAGCTGGAAAAGGAGGCGGCATTC
CTAACCATCGTCTGTATGGAGGAGATGGAGGACATGGAGAAGAAACTGGGCCCGTGCCTGCAGCTGTATG
TTCCAGAGGTGTCACCAGAAAGCATCATGGAGTGTGCCACCGGAAAACGAGGCACAGAGCTGATGCATGA
GAACGCCCAGCTCACAGATGCCCTACAGCCACCCCATGAGTATGTGCCCTGGGTCCTGGTCAACGAGAAA
CCGTTGACGGACCCCAGCCAGCTCCTGAGCTCCGTTTGTGAGCTGTACCAGGGGACAGAGAAGCCAGACA
TCTGCTCCTCCATGGCTGATGCCCCCAGGGAGGTCTGCTATAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001030026
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001030026.1, NP_001025197.1
RefSeq Size 1333 bp
RefSeq ORF 747 bp
Locus ID 290644
UniProt ID Q499T2
Gene Summary Lysosomal thiol reductase that can reduce protein disulfide bonds. May facilitate the complete unfolding of proteins destined for lysosomal degradation. Plays an important role in antigen processing. Facilitates the generation of MHC class II-restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. Facilitates also MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...