Mapkapk3 (NM_001012127) Rat Untagged Clone

CAT#: RN204033

Mapkapk3 (untagged ORF) - Rat mitogen-activated protein kinase-activated protein kinase 3 (Mapkapk3), (10 ug)



  "NM_001012127" in other vectors (3)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MAPKAP-K3; MK-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204033 representing NM_001012127
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGGCGAGACGGCGGGGGAGAAGGGGAGTCTTGTGCCCCAGCCAGGTGCGCTCGGTGCGCCCGCCT
TGGGCGGTGCTCCGGCCCCAGGTGTGCGACGGGAACCCAAGAAGTACGCGGTGACTGATGACTACCAGTT
GTCCAAGCAAGTGCTGGGTCTGGGTGTGAACGGCAAGGTACTAGAGTGCTACCATCGGCGCTCTGGGCAG
AAGTGTGCCTTGAAGCTCCTGTATGACAGCCCCAAGGCCCGGCAGGAGGTGGACCACCACTGGCAGGCCT
CAGGCGGCCCCCACATTGTGCGCATCCTGGACGTGTACGAGAACATGCATCACGGCAAGCGCTGCCTCCT
CATCGTCATGGAATGCATGGAGGGTGGTGAGCTGTTCAGCAGGATTCAGGAGCGCGGTGATCAGGCTTTC
ACTGAGAGAGAGGCCGCAGAGATAATGCGGGACATTGGCACTGCCATCCAGTTCTTGCACAGCCAGAACA
TTGCCCACCGAGATGTCAAGCCTGAAAACCTACTCTATACATCCAAGGAGAAGGATGCTGTACTTAAACT
CACTGATTTTGGCTTTGCCAAGGAAACCACCCAAAATGCCCTCCAGACACCCTGTTACACTCCCTATTAT
GTGGCTCCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCGTGCGATATGTGGTCCCTGGGGGTCATCA
TGTACATCCTTTTGTGTGGATTCCCACCCTTCTACTCCAACACGGGCCAGGCCATCTCTCCAGGAATGAA
GAGAAGGATTCGCTTGGGCCAGTATGGCTTCCCTAAACCTGAATGGGCAGACGTCTCTGAGGATGCCAAG
CAGCTAATCCGTCTGCTCCTGAAGACAGATCCCACCGAGAGGCTGACCATCATGCAGTTTATGAACCATC
CTTGGATCAATCAATCGATGGAGGTCCCACAGACCCCACTCCATACAGCCCGAGTGCTGGAGGAAGACAA
AGACCACTGGGATGACGTCAAGGAAGAGATGACCAGTGCCCTGGCCACGATGAGGGTAGACTACGACCAG
GTGAAAATCAAGGACCTGAAGACCTCTAACAACCGACTCCTCAACAAGCGGAGGAAAAAGCAGGGGGGCA
GCTCCTCAGCCTCACCGGGATGCAACAACCAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001012127
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012127.1, NP_001012127.1
RefSeq Size 2634 bp
RefSeq ORF 1155 bp
Locus ID 315994
UniProt ID Q66H84
Gene Summary Stress-activated serine/threonine-protein kinase involved in cytokines production, endocytosis, cell migration, chromatin remodeling and transcriptional regulation. Following stress, it is phosphorylated and activated by MAP kinase p38-alpha/MAPK14, leading to phosphorylation of substrates. Phosphorylates serine in the peptide sequence, Hyd-X-R-X(2)-S, where Hyd is a large hydrophobic residue. MAPKAPK2 and MAPKAPK3, share the same function and substrate specificity, but MAPKAPK3 kinase activity and level in protein expression are lower compared to MAPKAPK2. Phosphorylates HSP27/HSPB1, KRT18, KRT20, RCSD1, RPS6KA3, TAB3 and TTP/ZFP36. Mediates phosphorylation of HSP27/HSPB1 in response to stress, leading to dissociate HSP27/HSPB1 from large small heat-shock protein (sHsps) oligomers and impair their chaperone activities and ability to protect against oxidative stress effectively. Involved in inflammatory response by regulating tumor necrosis factor (TNF) and IL6 production post-transcriptionally: acts by phosphorylating AU-rich elements (AREs)-binding proteins, such as TTP/ZFP36, leading to regulate the stability and translation of TNF and IL6 mRNAs. Phosphorylation of TTP/ZFP36, a major post-transcriptional regulator of TNF, promotes its binding to 14-3-3 proteins and reduces its ARE mRNA affinity leading to inhibition of dependent degradation of ARE-containing transcript. Involved in toll-like receptor signaling pathway (TLR) in dendritic cells: required for acute TLR-induced macropinocytosis by phosphorylating and activating RPS6KA3. Also acts as a modulator of Polycomb-mediated repression (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...