Cidec (NM_001024333) Rat Untagged Clone
CAT#: RN203369
Cidec (untagged ORF) - Rat cell death-inducing DFFA-like effector c (Cidec), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN203369 representing NM_001024333
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCTAACACAATCCAGCTGACAAGAATGGACTATGCTATGAAGTCTCTCAGCCTTCTCTACCCTA GGTCACTGTCCAGGCATGTAGCAGTGAGCACTGCAGTGGTGACCCAACAGCTGGTGTCTGAGCCCAGCCG GGAGACCCCCAGGGCAAGACCCTGTCGTGTTAGCACCGCAGATCGGAAGGTTCGCAAAGGCATCATGGCC CACAGCTTGGAGGACCTCCTGGGCAAGGTCCAAGACATCTTGAAGCTTAAAGACAAGCCCTTCTCCCTGG TGTTGGAGGAAGATGGCACAATCGTGGAGACAGAAGAATACTTCCAAGCCCTACCAAGAGATACAGTGTT CATGGTCCTGCAGAAGGGGCAGAAGTGGAAGTCCCCATCAGAACAGCGCAAGAAGAAAGCCCAGCTATCC CTTTCCCAGAAGCCAACTAAGAAGATCGACGTGGCCCGGGTAACCTTTGACCTGTACAAGCTGAACCCTC AGGACTTCATCGGCTGCCTGAACGTGAAGGCAACCCTCTATGACACATACTCGCTTTCATATGACCTGCA CTGCTACAGGGCCAAACGCATCGTGAAGGAAATGCTCCGCTGGACTCTCTTCAGTATGCAAGCCACAGGC CACATGCTGCTTGGCACCTCCAGTTACATGCAGCAGTTCCTGGATGCCACTGAGGAAGAACAGCCCTCCA AGGCCAAGGCCTCCCTCCTCCCTGCCTGTCTGAAGATGCTGCAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024333 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024333.2, NP_001019504.2 |
RefSeq Size | 1654 bp |
RefSeq ORF | 747 bp |
Locus ID | 500292 |
UniProt ID | Q5XI33 |
Gene Summary | Binds to lipid droplets and regulates their enlargement, thereby restricting lipolysis and favoring storage. At focal contact sites between lipid droplets, promotes directional net neutral lipid transfer from the smaller to larger lipid droplets. The transfer direction may be driven by the internal pressure difference between the contacting lipid droplet pair. Its role in neutral lipid transfer and lipid droplet enlargement is activated by the interaction with PLIN1. May act as a CEBPB coactivator in the white adipose tissue to control the expression of a subset of CEBPB downstream target genes, including SOCS1, SOCS3, TGFB1, TGFBR1, ID2 and XDH. When overexpressed in preadipocytes, induces apoptosis or increases cell susceptibility to apoptosis induced by serum deprivation or TGFB treatment. The physiological significance of its role in apoptosis is unclear (By similarity). May play a role in the modulation of the response to osmotic stress by preventing NFAT5 to translocate into the nucleus and activate its target genes expression.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR203369 | Cidec (Myc-DDK-tagged ORF) - Rat cell death-inducing DFFA-like effector c (Cidec), (10 ug) |
CNY 3990.00 |
|
RR203369L3 | Lenti ORF clone of Cidec (Myc-DDK-tagged ORF) - Rat cell death-inducing DFFA-like effector c (Cidec), (10 ug) |
CNY 6080.00 |
|
RR203369L4 | Lenti ORF clone of Cidec (mGFP-tagged ORF) - Rat cell death-inducing DFFA-like effector c (Cidec), (10 ug) |
CNY 6650.00 |