Selenok (NM_207589) Rat Untagged Clone
CAT#: RN203063
Selk (untagged ORF) - Rat selenoprotein K (Selk), (Note, selenocysteine protein, internal stop codon, see reference data summary)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Synonyms | Selk |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN203063 representing NM_207589
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTTACATCTCGAATGGTCAGGTGTTAGACAGCCGGAATCAGTCCCCCTGGAGATTGTCTTTCATAA CAGATTTCTTCTGGGGAATAGCAGAATTTGTGGTTTTTTTTTTCAAAACTCTGCTTCAGCAAGATGTGAA GAAAAGAAGAGGCTACGGGGGCTCCTCTGATTCCAGATATGATGACGGAAGAGGGCCACCAGGAAACCCT CCACGAAGAATGGGTCGGATCAGTCACCTTCGTGGCCCCAGCCCTCCTCCAATGGCCGGTGGATGAGGAA GGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_207589 |
Insert Size | 285 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_207589.3, NP_997472.2 |
RefSeq Size | 752 bp |
RefSeq ORF | 285 bp |
Locus ID | 290549 |
UniProt ID | P59798 |
Gene Summary | The protein encoded by this gene belongs to the selenoprotein K family. It is a transmembrane protein that is localized in the endoplasmic reticulum (ER), and is involved in ER-associated degradation (ERAD) of misfolded, glycosylated proteins. It also has a role in the protection of cells from ER stress-induced apoptosis. Knockout studies in mice show the importance of this gene in promoting Ca(2+) flux in immune cells and mounting effective immune response. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Multiple pseudogenes of this locus have been identified. [provided by RefSeq, Aug 2017] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR203063 | Selk (Myc-DDK-tagged ORF) - Rat selenoprotein K (Selk), (10 ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 3990.00 |
其它Selenok产品