Pde6h (NM_053688) Rat Untagged Clone
CAT＃: RN202587
Pde6h (untagged ORF) - Rat phosphodiesterase 6H, cGMP-specific, cone, gamma (Pde6h), (10 ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | Pde6g |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN202587 representing NM_053688
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGACAGCCCTTGCCTGAGTCCTCCAGCACCAAGCCAGGGTCCTACTACCCCACGCAAAGGGCCCC CCAAGTTCAAGCAGAGGCAGACGCGACAGTTCAAGAGCAAGCCTCCCAAGAAAGGGGTGAAAGGGTTTGG AGATGACATCCCAGGCATGGAGGGGCTAGGAACAGATATCACGGTGATCTGCCCCTGGGAAGCATTCAGC CACCTGGAACTGCACGAGCTGGCTCAGTTCGGGATCATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_053688 |
| Insert Size | 252 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_053688.2, NP_446140.1 |
| RefSeq Size | 480 bp |
| RefSeq ORF | 252 bp |
| Locus ID | 114248 |
| UniProt ID | P61250 |
| Gene Summary | mouse homolog may play a role in mitogen activated protein kinase signaling [RGD, Feb 2006] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR202587 | Pde6h (Myc-DDK-tagged ORF) - Rat phosphodiesterase 6H, cGMP-specific, cone, gamma (Pde6h), (10 ug) |
CNY 3990.00 |
|
| RR202587L3 | Lenti ORF clone of Pde6h (Myc-DDK-tagged ORF) - Rat phosphodiesterase 6H, cGMP-specific, cone, gamma (Pde6h), (10 ug) |
CNY 6080.00 |
|
| RR202587L4 | Lenti ORF clone of Pde6h (mGFP-tagged ORF) - Rat phosphodiesterase 6H, cGMP-specific, cone, gamma (Pde6h), (10 ug) |
CNY 6650.00 |
