Med20 (NM_001013178) Rat Untagged Clone

CAT#: RN202486

Med20 (untagged ORF) - Rat mediator complex subunit 20 (Med20), (10 ug)



  "NM_001013178" in other vectors (3)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Trfp; Usp49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202486 representing NM_001013178
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGTGACGTGTGTGTCCCAGATGCCTGTGGCTGAGGGCAAGAGTGTCCAGCAGACAGTGGAGCTCC
TCACCAAGAAATTGGAGATGCTTGGAGCAGAGAAACAAGGAACATTTTGTGTGGACTGTGAAACTTACCA
CACAGCTGCCTCCACCCTGGGCAGCCAAGGCCAGGCTGGGAAGCTGATGTACGTGATGCATAACTCTGAG
TACCCACTGAGCTGCTTTGCCCTCTTTGAGAATGGCCCTTGCCTTATTGCTGACACCAACTTCGATGTGC
TCATGGTGAAGCTCAAGGGCTTTTTCCAGAGTGCCAAGGCCAGCAAGATTGAGACCCGGGGTACTCGCTA
CCAGTATTGTGACTTCCTGGTGAAGGTGGGCACGGTCACAATGGGGCCCAGTGCCCGTGGCATCTCTGTG
GAGGTGGAGTATGGCCCTTGTGTGGTAGCTAGTGACTGCTGGAGCCTCCTGCTTGAATTCCTACAGAGTT
TTCTAGGTAGCCACACACCAGGGGCGCCCACAGTGTTTGGGAACAGACATGATGCGGTCTACGGGCCAGC
AGATACCATGGTACAGTACATGGAGCTCTTCAACAAGGTCCGGAAACAGCAGCAAGTGCCTGTGGCTGGG
ATCCGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001013178
Insert Size 639 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001013178.2, NP_001013196.1
RefSeq Size 1964 bp
RefSeq ORF 639 bp
Locus ID 316209
UniProt ID Q5XIE9
Gene Summary Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...