Vps26a (NM_001007740) Rat Untagged Clone

CAT#: RN202230

Vps26a (untagged ORF) - Rat vacuolar protein sorting 26 homolog A (S. pombe) (Vps26a), (10 ug)



  "NM_001007740" in other vectors (3)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Vps26
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202230 representing NM_001007740
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTTTTCTTGGAGGCTTTTTTGGTCCCATCTGTGAGATCGATGTTGCCCTTAGTGATGGGGAGACCA
GGAAAATGGCAGAAATGAAAACGGAAGATGGCAAAGTAGAAAAACACTATCTCTTCTATGATGGGGAATC
TGTCTCAGGAAAGGTAAACCTAGCCTTTAAGCAGCCTGGAAAGAGGCTAGAGCATCAAGGAATTAGAATT
GAATTTGTAGGTCAAATTGAGCTTTTCAATGACAAGAGTAATACTCATGAATTTGTAAACCTAGTGAAGG
AACTAGCCTTGCCTGGAGAGCTGACTCAGAGCAGAAGCTATGACTTTGAATTCATGCAAGTTGAAAAGCC
ATATGAGTCATACATCGGTGCCAATGTCCGCCTGAGGTATTTCCTTAAGGTGACCATTGTGAGAAGACTG
ACAGACTTAGTGAAAGAGTACGATCTTATTGTTCACCAGCTCGCCACCTACCCAGAGGTCAACAACTCCA
TTAAAATGGAGGTGGGAATTGAAGACTGTCTGCACATAGAGTTTGAGTACAATAAGTCCAAGTATCATTT
AAAGGATGTAATTGTTGGAAAAATTTACTTCTTATTAGTAAGAATAAAAATACAACACATGGAGTTACAG
CTGATCAAGAAAGAGATCACAGGAATTGGACCCAGCACCACAACAGAGACAGAAACAATCGCTAAGTATG
AAATAATGGATGGGGCGCCAGTAAAAGGAGAATCTATTCCGATAAGATTGTTCTTAGCAGGGTATGACCC
AACCCCCACAATGAGAGATGTGAACAAGAAGTTTTCAGTAAGGTACTTTTTGAACCTCGTGCTTGTTGAT
GAGGAGGACAGAAGGTACTTCAAGCAGCAGGAGATTATCCTGTGGAGAAAAGCACCTGAGAAACTGAGAA
AACAGAGGACGAACTTTCACCAGCGATTTGAATCTCCAGAATCGCAGGCGTCTGCAGAACAGCCTGAGAT
GTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001007740
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007740.1, NP_001007741.1
RefSeq Size 1292 bp
RefSeq ORF 984 bp
Locus ID 361846
UniProt ID Q6AY86
Gene Summary Acts as component of the retromer cargo-selective complex (CSC). The CSC is believed to be the core functional component of retromer or respective retromer complex variants acting to prevent missorting of selected transmembrane cargo proteins into the lysosomal degradation pathway. The recruitment of the CSC to the endosomal membrane involves RAB7A and SNX3.The SNX-BAR retromer mediates retrograde transport of cargo proteins from endosomes to the trans-Golgi network (TGN) and is involved in endosome-to-plasma membrane transport for cargo protein recycling. The SNX3-retromer mediates the retrograde endosome-to-TGN transport of WLS distinct from the SNX-BAR retromer pathway. The SNX27-retromer is believed to be involved in endosome-to-plasma membrane trafficking and recycling of a broad spectrum of cargo proteins. The CSC complex seems to act as recruitment hub for other proteins, such as the WASH complex and TBC1D5. Required for retrograde transport of lysosomal enzyme receptor IGF2R. Required to regulate transcytosis of the polymeric immunoglobulin receptor (pIgR-pIgA). Required for the endosomal localization of WASHC2 (indicative for the WASH complex). Required for the endosomal localization of TBC1D5. Mediates retromer cargo recognition of SORL1 and is involved in trafficking of SORL1 implicated in sorting and processing of APP. Involved in retromer-independent lysosomal sorting of F2R. Involved in recycling of ADRB2. Acts redundantly with VSP26B in SNX-27 mediated endocytic recycling of SLC2A1/GLUT1. Enhances the affinity of SNX27 for PDZ-binding motifs in cargo proteins (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...