3110043O21Rik (BC026738) Mouse Tagged ORF Clone
CAT#: MR204567
- TrueORF®
3110043O21Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 3110043O21 gene (cDNA clone MGC:25598 IMAGE:4020832)
ORF Plasmid: tGFP
"BC026738" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 3140.00
Cited in 1 publication. |
CNY 300.00
CNY 6840.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | AI840585 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR204567 representing BC026738
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAGATCAGGGTCAGAGTATCATTCCCATGCTTACTGGGGAGGTCATTCCTGTAATGGAGCTGCTTG CATCTATGAAATCCCACAGTGTTCCTGAAGACATTGATATAGCTGATACAGTGCTCAATGATGATGACAT TGGTGACAGCTGTCACGAAGGCTTTCTTCTCAATGCCATCAGCTCACACCTGCAGACCTGTGGCTGTTCT GTTGTAGTTGGCAGCAGTGCAGAGAAAGTAAATAAGATAGTAAGAACACTGTGCCTTTTTCTGACACCAG CAGAGAGGAAATGCTCCAGGCTGTGTGAAGCAGAATCGTCCTTTAAGTACGAATCGGGACTCTTTGTGCA AGGCTTGCTAAAGGATGCAACAGGCAGTTTTGTCCTACCCTTCCGGCAAGTTATGTATGCCCCGTACCCC GCCACGCACATTGATGTGGATGTCAACACTGTCAAGCAGATGCCACCGTGTCATGAACATATTTATAATC AACGCAGATACATGAGGTCAGAGCTGACAGCCTTCTGGAGGGCAACTTCAGAAGAGGACATGGCGCAGGA CACCATCATCTACACAGATGAGAGCTTCACTCCTGATTTGAATATTTTCCAAGATGTCTTACACAGAGAC ACTCTAGTGAAAGCCTTCCTGGATCAGGTCTTCCATTTGAAGCCTGGCCTGTCTCTCAGGAGTACTTTCC TTGCACAGTTCCTCCTCATTCTTCACAGAAAAGCCTTGACACTAATCAAGTACATCGAGGATGATACGCA GAAGGGGAAAAAGCCCTTTAAGTCTCTTCGGAACCTGAAGATAGATCTTGATTTAACAGCAGAGGGCGAT CTTAACATAATAATGGCTCTAGCTGAGAAAATTAAGCCAGGCCTACACTCTTTCATCTTTGGGAGACCTT TCTACACTAGTGTACAAGAACGTGATGTTCTAATGACCTTT ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene |
ACCN | BC026738 |
ORF Size | 951 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC026738, AAH26738 |
RefSeq Size | 2613 bp |
RefSeq ORF | 953 bp |
Locus ID | 73205 |
MW | 95.8 kDa |
Gene Summary | Component of the C9orf72-SMCR8 complex, a complex that has guanine nucleotide exchange factor (GEF) activity and regulates autophagy (PubMed:27193190, PubMed:27617292). In the complex, C9orf72 and SMCR8 probably constitute the catalytic subunits that promote the exchange of GDP to GTP, converting inactive GDP-bound RAB8A and RAB39B into their active GTP-bound form, thereby promoting autophagosome maturation (By similarity). The C9orf72-SMCR8 complex also acts as a regulator of autophagy initiation by interacting with the ATG1/ULK1 kinase complex and modulating its protein kinase activity (PubMed:27193190, PubMed:27617292). Positively regulates initiation of autophagy by regulating the RAB1A-dependent trafficking of the ATG1/ULK1 kinase complex to the phagophore which leads to autophagosome formation (By similarity). Acts as a regulator of mTORC1 signaling by promoting phosphorylation of mTORC1 substrates (PubMed:27875531). Plays a role in endosomal trafficking (PubMed:26989253). May be involved in regulating the maturation of phagosomes to lysosomes (PubMed:26989253). Regulates actin dynamics in motor neurons by inhibiting the GTP-binding activity of ARF6, leading to ARF6 inactivation (PubMed:27723745). This reduces the activity of the LIMK1 and LIMK2 kinases which are responsible for phosphorylation and inactivation of cofilin, leading to cofilin activation (PubMed:27723745). Positively regulates axon extension and axon growth cone size in spinal motor neurons (PubMed:27723745). Plays a role within the hematopoietic system in restricting inflammation and the development of autoimmunity (PubMed:27412785).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Novel antibodies reveal presynaptic localization of C9orf72 protein and reduced protein levels in C9orf72 mutation carriers
,Frick, P;Sellier, C;Mackenzie, IRA;Cheng, CY;Tahraoui-Bories, J;Martinat, C;Pasterkamp, RJ;Prudlo, J;Edbauer, D;Oulad-Abdelghani, M;Feederle, R;Charlet-Berguerand, N;Neumann, M;,
Acta Neuropathol Commun
,PubMed ID 30075745
[3110043O21Rik]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC217897 | 3110043O21Rik (untagged) - Mouse RIKEN cDNA 3110043O21 gene (cDNA clone MGC:25598 IMAGE:4020832), (10ug) |
CNY 6940.00 |
|
MG204567 | 3110043O21Rik (tGFP-tagged) - Mouse RIKEN cDNA 3110043O21 gene (cDNA clone MGC:25598 IMAGE:4020832) |
CNY 3420.00 |
|
MR204567L3 | Lenti ORF clone of 3110043O21Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 3110043O21 gene (cDNA clone MGC:25598 IMAGE:4020832) |
CNY 5040.00 |
|
MR204567L4 | Lenti ORF clone of 3110043O21Rik (mGFP-tagged) - Mouse RIKEN cDNA 3110043O21 gene (cDNA clone MGC:25598 IMAGE:4020832) |
CNY 5040.00 |
其它3110043O21Rik产品