Setd4 (BC029101) Mouse Tagged ORF Clone
CAT#: MR203574
- TrueORF®
Setd4 (Myc-DDK-tagged) - Mouse SET domain containing 4 (cDNA clone MGC:27899 IMAGE:3499483)
ORF Plasmid: tGFP
"BC029101" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 2660.00
CNY 300.00
CNY 6840.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | AY037804; C21orf18; ORF21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR203574 representing BC029101
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGAGACGAAGAGGAAGAACAGAGAGGGCCAGGAAGAGACGGCGGCGAAGCTCTGGTTCAAGAGCAG TGAATGAGAGCTACAGATCAGAATTTATAGAGCTAAGAAAATGGCTGAAAGAAAGGAAGTTTGAAGACAC AGACTTAGTACCCGCCAGCTTTCCAGGAACAGGAAGAGGGCTGATGAGCAAAGCATCGTTGCAGGAGGGC CAGGTGATGATCTCACTGCCTGAGAGCTGTCTGCTCACCACGGACACTGTGATTCGAAGCTCCCTAGGGC CCTACATTAAGAAGTGGAAGCCTCCTGTGTCTCCTCTGCTGGCCTTGTGTACTTTCTTAGTCTCAGAAAA GCATGCCGGCTGTCGGTCCCTCTGGAAGTCTTACCTGGACATCTTACCCAAGTCATACACCTGCCCGGTG TGTTTGGAGCCGGAAGTGGTAGATCTTCTTCCCAGCCCTTTAAAGGCGAAGGCGGAAGAGCAGAGAGCCC GAGTGCAGGACCTGTTTACCTCCGCTAGAGGCTTCTTCTCTACCCTGCAGCCTCTGTTTGCAGAGCCTGT GGACAGCGTTTTCAGCTACCGAGCCTTCCTGTGGGCCTGGTGCACGGTGAACACCAGGGCTGTGTACCTG AGGTCCAGGAGGCAGGAGTGCCTTTCCGCAGAGCCGGACACGTGTGCGCTTGCTCCGTTCCTGGACCTGC TGAATCACAGCCCACATGTGCAGGTGAGAGGGCGGCATGGAGACAGGTCCTGCCGTTACAGAAGCCTGCC ATGTAGGGACAAGGGTTCTGAGTCAAGGATGGAATGG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene |
ACCN | BC029101 |
ORF Size | 807 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC029101 |
RefSeq Size | 2360 bp |
RefSeq ORF | 809 bp |
Locus ID | 224440 |
MW | 86.5 kDa |
Gene Summary | Histone-lysine N-methyltransferase that acts as a regulator of cell proliferation, cell differentiation and inflammatory response (PubMed:31376731, PubMed:31794893, PubMed:33506343). Regulates the inflammatory response by mediating mono- and dimethylation of 'Lys-4' of histone H3 (H3K4me1 and H3K4me2, respectively), leading to activate the transcription of proinflammatory cytokines IL6 and TNF-alpha (PubMed:31376731). Also involved in the regulation of stem cell quiescence by catalyzing the trimethylation of 'Lys-20' of histone H4 (H4K20me3), thereby promoting heterochromatin formation (By similarity). Involved in proliferation, migration, paracrine and myogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) (PubMed:33506343).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC218589 | Setd4 (untagged) - Mouse SET domain containing 4 (cDNA clone MGC:27899 IMAGE:3499483), (10ug) |
CNY 6940.00 |
|
MG203574 | Setd4 (tGFP-tagged) - Mouse SET domain containing 4 (cDNA clone MGC:27899 IMAGE:3499483) |
CNY 2950.00 |
|
MR203574L3 | Lenti ORF clone of Setd4 (Myc-DDK-tagged) - Mouse SET domain containing 4 (cDNA clone MGC:27899 IMAGE:3499483) |
CNY 4560.00 |
|
MR203574L4 | Lenti ORF clone of Setd4 (mGFP-tagged) - Mouse SET domain containing 4 (cDNA clone MGC:27899 IMAGE:3499483) |
CNY 4560.00 |