Tec (NM_013689) Mouse Untagged Clone

CAT#: MC228178

Tec (untagged) - Mouse tec protein tyrosine kinase (Tec), transcript variant 4



  "NM_013689" in other vectors (1)

CNY 5130.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228178 representing NM_013689
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGTGTCATTCCCTGTCAAAATAAATTTCCATTCCAGTCCACAAAGCAGGGACCGATGGGTGAAGA
AGTTAAAAGAAGAAATAAAGAACAACAATAATATCATGATTAAATACCATCCTAAATTCTGGGCAGATGG
GAGTTACCAGTGTTGTAGACAAACAGAAAAACTAGCACCCGGATGTGAGAAGTACAATCTTTTTGAGAGT
AGTATAAGAAAGACCCTGCCTCCCGCGCCAGAAATAAAGAAGAGAAGGCCTCCTCCACCAATTCCCCCAG
AGGAAGAAAATACTGAAGAAATCGTTGTAGCGATGTATGACTTCCAAGCGACGGAAGCACATGACCTCAG
GTTAGAGAGAGGCCAAGAGTATATCATCCTGGAAAAGAATGACCTCCATTGGTGGAGAGCGAGAGATAAG
TATGGGTGGTACTGCAGAAATACCAACAGAAGCAAAGCAGAACAGCTCCTCAGAACGGAAGATAAAGAAG
GTGGTTTTATGGTGAGAGACTCCAGTCAACCAGGCTTGTACACTGTCTCCCTTTACACAAAGTTTGGGGG
AGAAGGCTCATCAGGTTTCAGGCATTATCACATAAAGGAAACAGCAACATCCCCAAAGAAGTATTACCTG
GCAGAGAAGCATGCTTTCGGGTCCATTCCTGAGATCATTGAATATCACAAGCACAATGCGGCAGGGCTTG
TCACCAGGCTGCGGTACCCGGTCAGTACAAAGGGGAAGAACGCTCCCACTACTGCCGGCTTCAGCTATGA
TAAGTGGGAGATTAACCCATCAGAGCTGACCTTTATGAGAGAGTTGGGGAGCGGACTGTTTGGAGTGGTG
AGGCTTGGCAAGTGGCGGGCCCAGTACAAAGTGGCCATCAAAGCTATCCGGGAAGGCGCCATGTGTGAAG
AGGATTTCATAGAGGAAGCTAAAGTCATGATGAAGCTGACACACCCCAAGCTGGTACAGCTCTATGGTGT
ATGCACCCAGCAGAAGCCCATCTACATCGTTACCGAGTTCATGGAACGGGGCTGCCTTCTGAATTTCCTC
CGGCAGAGACAAGGCCATTTCAGCAGAGACATGCTGCTAAGCATGTGTCAAGATGTCTGTGAAGGGATGG
AGTACCTGGAGAGAAACAGCTTCATCCACAGAGACCTGGCTGCCAGAAATTGTCTAGTGAATGAAGCAGG
AGTTGTCAAAGTATCTGATTTTGGAATGGCCAGGTACGTTCTGGATGATCAGTACACAAGTTCTTCTGGC
GCCAAGTTCCCTGTGAAGTGGTGTCCCCCAGAAGTGTTTAATTACAGCCGCTTTAGCAGCAAGTCAGACG
TCTGGTCGTTTGGTGTGCTAATGTGGGAAATATTCACAGAAGGCAGGATGCCCTTTGAGAAGAACACCAA
TTACGAAGTGGTAACCATGGTGACTCGTGGCCACCGCCTCCACCGGCCAAAGCTGGCTTCCAAATATTTG
TATGAGGTGATGCTGAGATGCTGGCAAGAGAGACCAGAGGGAAGGCCTTCCTTTGAAGACTTGCTGCGTA
CGATAGATGAACTAGTTGAATGTGAAGAAACTTTTGGAAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013689
Insert Size 1584 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013689.5, NP_038717.2
RefSeq Size 2554 bp
RefSeq ORF 1584 bp
Locus ID 21682
Gene Summary Non-receptor tyrosine kinase that contributes to signaling from many receptors and participates as a signal transducer in multiple downstream pathways, including regulation of the actin cytoskeleton. Plays a redundant role to ITK in regulation of the adaptive immune response. Regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. Required for TCR-dependent IL2 gene induction. Phosphorylates DOK1, one CD28-specific substrate, and contributes to CD28-signaling. Mediates signals that negatively regulate IL2RA expression induced by TCR cross-linking. Plays a redundant role to BTK in BCR-signaling for B-cell development and activation, especially by phosphorylating STAP1, a BCR-signaling protein. Required in mast cells for efficient cytokine production. Involved in both growth and differentiation mechanisms of myeloid cells through activation by the granulocyte colony-stimulating factor CSF3, a critical cytokine to promoting the growth, differentiation, and functional activation of myeloid cells. Participates in platelet signaling downstream of integrin activation. Cooperates with JAK2 through reciprocal phosphorylation to mediate cytokine-driven activation of FOS transcription. GRB10, a negative modifier of the FOS activation pathway, is another substrate of TEC. TEC is involved in G protein-coupled receptor- and integrin-mediated signalings in blood platelets. Plays a role in hepatocyte proliferation and liver regeneration and is involved in HGF-induced ERK signaling pathway. TEC regulates also FGF2 unconventional secretion (endoplasmic reticulum (ER)/Golgi-independent mechanism) under various physiological conditions through phosphorylation of FGF2 'Tyr-82'. May also be involved in the regulation of osteoclast differentiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate splice site and lacks an alternate in-frame exon in the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform c, which is shorter and has a distinct N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...