Sqstm1 (NM_001290769) Mouse Untagged Clone

CAT#: MC227518

Sqstm1 (untagged) - Mouse sequestosome 1 (Sqstm1), transcript variant 2



  "NM_001290769" in other vectors (1)

CNY 3800.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SQSTM1 Rabbit pAb
    • 100 ul

CNY 1999.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A170; OSF-6; Osi; p62; STAP; STONE14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227518 representing NM_001290769
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCGTTCACGGTGAAGGCCTATCTTCTGGGCAAGGAGGAGGCGACCCGCGAGATCCGCCGCTTCA
GCTTCTGCTTCAGCCCGGAGCCGGAGGCGGAAGCCCAAGCCGCGGCCGGCCCGGGGCCCTGCGAGAGGCT
GCTGAGCCGAGTGGCTGTGCTGTTCCCCACGCTGAGGCCTGGCGGCTTCCAGGCGCACTACCGCGATGAG
GATGGGGACTTGGTTGCCTTTTCCAGTGATGAGGAGCTGACAATGGCTATGTCCTATGTGAAAGATGACA
TCTTCCGCATCTACATTAAAGAGAAGAAGGAGTGCCGGCGGGAACATCGCCCACCATGTGCTCAGGAGGC
ACCCCGAAACATGGTGCACCCCAATGTGATCTGTGATGGTTGCAACGGGCCTGTGGTGGGAACTCGCTAT
AAGTGCAGTGTGTGCCCAGACTACGACCTGTGCAGCGTGTGCGAGGGGAAGGGCCTGCACAGGGAACACA
GCAAGCTCATCTTTCCCAACCCCTTTGGCCACCTCTCTGATAGCTTCTCTCATAGCCGCTGGCTTCGGAA
GCTGAAACATGGACACTTTGGCTGGCCTGGCTGGGAGATGGGCCCACCGGGGAACTGGAGCCCACGTCCT
CCTCGTGCAGGGGATGGCCGCCCTTGCCCTACAGCTGAGTCAGCTTCTGCTCCACCAGAAGATCCCAATG
TCAATTTCCTGAAGAATGTGGGGGAGAGTGTGGCAGCTGCCCTCAGCCCTCTAGGCATTGAGGTTGACAT
TGATGTGGAACATGGAGGGAAGAGAAGCCGCCTGACACCCACTACCCCAGAAAGTTCCAGCACAGGCACA
GAAGACAAGAGTAACACTCAGCCAAGCAGCTGCTCTTCGGAAGTCAGCAAACCTGACGGGGCTGGGGAGG
GCCCTGCTCAGTCTCTGACAGAGCAAATGAAAAAGATAGCCTTGGAGTCGGTGGGACAGCCAGAGGAACA
GATGGAGTCGGGAAACTGCTCAGGAGGAGACGATGACTGGACACATTTGTCTTCAAAAGAAGTGGACCCA
TCTACAGAGGCTGATCCCCGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATGGGTTTCTCGGATGAAG
GCGGCTGGCTCACCAGGCTCCTACAGACCAAGAATTACGACATCGGGGCTGCTCTGGACACGATCCAGTA
TTCGAAGCACCCTCCACCATTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290769
Insert Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290769.1, NP_001277698.1
RefSeq Size 1916 bp
RefSeq ORF 1215 bp
Locus ID 18412
UniProt ID Q64337
Gene Summary Autophagy receptor required for selective macroautophagy (aggrephagy). Functions as a bridge between polyubiquitinated cargo and autophagosomes. Interacts directly with both the cargo to become degraded and an autophagy modifier of the MAP1 LC3 family. Required both for the formation and autophagic degradation of polyubiquitin-containing bodies, called ALIS (aggresome-like induced structures) and links ALIS to the autophagic machinery. Involved in midbody ring degradation (By similarity). May regulate the activation of NFKB1 by TNF-alpha, nerve growth factor (NGF) and interleukin-1. May play a role in titin/TTN downstream signaling in muscle cells. May regulate signaling cascades through ubiquitination. Adapter that mediates the interaction between TRAF6 and CYLD (PubMed:14960283, PubMed:18382763). May be involved in cell differentiation, apoptosis, immune response and regulation of K(+) channels. Involved in endosome organization by retaining vesicles in the perinuclear cloud: following ubiquitination by RNF26, attracts specific vesicle-associated adapters, forming a molecular bridge that restrains cognate vesicles in the perinuclear region and organizes the endosomal pathway for efficient cargo transport (By similarity). Promotes relocalization of 'Lys-63'-linked ubiquitinated TMEM173/STING to autophagosomes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region but maintains reading frame, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...