Nlrc3 (NM_175547) Mouse Untagged Clone

CAT#: MC227484

Nlrc3 (untagged) - Mouse NLR family, CARD domain containing 3 (Nlrc3), transcript variant 2



  "NM_175547" in other vectors (1)

CNY 3800.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CLR16.2; D230007K08Rik; mFLJ00348
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227484 representing NM_175547
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGAAGCCTGGCTGAGAATCAGATTGGTAACAAAGGAGCCAAAGCCCTGGCCAGATCCCTCCTGG
TTAACAGAAGCCTCATCACACTGGACCTCCGGAGTAACAGCATTGGACCACCGGGGGCTAAGGCTTTGGC
CGATGCTCTGAAGATAAACCGAACGCTAACTTCTCTAAGCCTCCAAAGCAACGTGATCAAGGATGACGGT
GTCATGTGCGTGGCTGAGGCCCTGGTCTCCAACCAGACCATCTCCATGCTACAGCTACAGAAGAACTTAA
TTGGGCTCATAGGAGCCCAGCAGATGGCAGATGCCCTGAAGCAGAACAGGAGCCTGAAAGCACTCATGTT
TTCCAGTAATACCATTGGCGACAGAGGTGCCATAGCCCTGGCTGAGGCCCTGAAGGTGAACCAGATCCTG
GAGAACTTAGACCTACAGAGCAATTCCATCAGTGACATGGGAGTGACGGTGCTGATGCGAGCCCTCTGCA
GTAACCAGACACTCTCCAGTCTCAACCTGCGAGAAAACTCCATCAGCCCAGAGGGAGCCCAGGCCCTCAC
TCAAGCTCTCTGCAGGAACAACACTCTGAAGCACTTGGACCTGACAGCTAATCTCCTCCATGACCGAGGT
GCCCAGGCCATTGCAGTAGCTGTGGGAGAAAACCACTCCCTCACACACCTTCACCTGCAGTGGAACTTCA
TCCAAGCTGGTGCGGCCAGGGCCCTGGGACAAGCACTCCAGCTGAACAGAACCCTGACAACCTTAGACTT
ACAGGAGAATGCCATAGGGGATGAAGGAGCTTCCTCAGTGGCTGGCGCACTGAAGGTGAACACAACCCTC
ATTGCTCTCTACCTACAGGTGGCCTCCATTGGTAGCCAAGGGGCCCAGGCACTTGGGGAGGCCCTCACTG
TGAACAGAACCTTGGAGATTCTTGACTTACGAGGAAACGACGTTGGGGCAGCTGGAGCCAAGGCCTTGGC
AAATGCTTTAAAGTTAAACTCCAGTCTCCGAAGACTCAATCTCCAGGAGAACTCACTGGGGATGGATGGG
GCCATATTTGTTGCCTCTGCACTGTCTGAGAACCACGGTCTGCACCATATTAATCTCCAGGGGAATCCCA
TTGGGGAGTCTGCTGCCAGGATGATCTCAGAGGCCATCAAGACAAACGCTCCCACATGCACTGTGGAAAT
ATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_175547
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_175547.3, NP_780756.1
RefSeq Size 2003 bp
RefSeq ORF 1194 bp
Locus ID 268857
UniProt ID Q5DU56
Gene Summary Negative regulator of the innate immune response. Attenuates signaling pathways activated by Toll-like receptors (TLRs) and the DNA sensor STING/TMEM173 in response to pathogen-associated molecular patterns, such as intracellular poly(dA:dT), but not poly(I:C), or in response to DNA virus infection, including that of Herpes simplex virus 1 (HSV1) (PubMed:22863753, PubMed:24560620). May affect TLR4 signaling by acting at the level of TRAF6 ubiquitination, decreasing the activating 'Lys-63'-linked ubiquitination and leaving unchanged the degradative 'Lys-48'-linked ubiquitination (PubMed:22863753). Inhibits the PI3K-AKT-mTOR pathway possibly by directly interacting with the posphatidylinositol 3-kinase regulatory subunit p85 (PIK3R1/PIK3R2) and disrupting the association between PIK3R1/PIK3R2 and the catalytic subunit p110 (PIK3CA/PIK3CB/PIK3CD) and reducing PIK3R1/PIK3R2 activation. Via its regulation of the PI3K-AKT-mTOR pathway, controls cell proliferation, predominantly in intestinal epithelial cells (PubMed:27951586). May also affect NOD1- or NOD2-mediated NF-kappa-B activation (By similarity). Might also affect the inflammatory response by preventing NLRP3 inflammasome formation, CASP1 cleavage and IL1B maturation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks two alternate exons in the 5' coding region and uses an alternate downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter and distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...