Rad51c (NM_001291440) Mouse Untagged Clone

CAT#: MC227426

Rad51c (untagged) - Mouse RAD51 homolog C (Rad51c), transcript variant 1



  "NM_001291440" in other vectors (1)

CNY 3710.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms R51H3; Rad51l2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227426 representing NM_001291440
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGTACAGGGTTCACTTGGCCTGGCTACCGTCTCCGCGTCTCCGGCCTCTTTTTTTGTTTTTGTGTT
CACTGTCAGGCTATATCCGAAACGTGACTCGGACGAGTGAAACTAGAAGACAACCTTACATGAAACCAGT
GTGTGGGATTTCCTCAGCAGCAGCAAGGCCTCAAGTTGGGATATCTAAAGAGGAAGCCTTGGAAACTCTA
CAAATTCTAAGAAGAGAATGTCTCACAAATAAACCAAGATGTGCCGGTACATCTGTGGCAAACGAGAAGT
GCACAGCACTGGAACTTCTCGAGCAAGAGCATACCCAGGGCTTCATAATCACCTTCTGTTCAGCACTCGA
TAACATTCTTGGGGGTGGAATACCCCTAATGAAGACGACAGAAGTTTGTGGTGTACCAGGTGTTGGAAAA
ACACAGTTATGTATGCAATTGGCAGTAGATGTGCAGATTCCAGAATGTTTTGGGGGCGTGGCCGGTGAAG
CAGTATTTATTGATACAGAGGGAAGTTTTATGGTTGATAGAGTGGTCAGCCTTGCAACTGCCTGCATTCA
GCACCTTCATCTCATAGCAGGAACACACACGGAAGAAGAACATCAGAAAGCCTTGAAGGATTTTACTCTT
GAAAATATTCTTTCCCATATTTATTATTTTCGTTGTCATGATTATACTGAGCTGCTGGCACAAGTCTATC
TCCTTCCAGATTTCCTTTCAGATCATCCAAAGGTGCAGCTAGTGATAATAGACGGAATTGCTTTTCCCTT
TCGTCATGACCTTGAAGATCTATCCCTTCGTACTCGATTACTAAATGGCCTCGCCCAACAAATGATCAGC
CTTGCAAATAATCACAGATTAGCTGTTATTTTAACTAATCAGATGACAACAAAGATTGATAAAAATCAAG
CTTTGCTTGTTCCTGCATTAGGGGAAAGCTGGGGGCATGCTGCTACAATAAGGCTCATTTTTCACTGGGA
ACAAAAGCAAAGATTTGCAACATTGTACAAGTCACCAAGCCAGAAGGAGTCTACGATACCATTTCAGATC
ACACCTCAGGGATTTAGAGACGCTGTTGTCACTGCTGCCTCATCACAGACAGAGAGTTCTTTGAATTTCC
GGAAACGGTCACGAGAACCAGAGGAAGAATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291440
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291440.1, NP_001278369.1
RefSeq Size 3122 bp
RefSeq ORF 1155 bp
Locus ID 114714
UniProt ID Q924H5
Gene Summary Essential for the homologous recombination (HR) pathway of DNA repair. Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA breaks arising during DNA replication or induced by DNA-damaging agents. Part of the RAD21 paralog protein complexes BCDX2 and CX3 which act at different stages of the BRCA1-BRCA2-dependent HR pathway. Upon DNA damage, BCDX2 seems to act downstream of BRCA2 recruitment and upstream of RAD51 recruitment; CX3 seems to act downstream of RAD51 recruitment; both complexes bind predominantly to the intersection of the four duplex arms of the Holliday junction (HJ) and to junction of replication forks. The BCDX2 complex was originally reported to bind single-stranded DNA, single-stranded gaps in duplex DNA and specifically to nicks in duplex DNA. The BCDX2 subcomplex RAD51B:RAD51C exhibits single-stranded DNA-dependent ATPase activity suggesting an involvement in early stages of the HR pathway. Involved in RAD51 foci formation in response to DNA damage suggesting an involvement in early stages of HR probably in the invasion step. Has an early function in DNA repair in facilitating phosphorylation of the checkpoint kinase CHEK2 and thereby transduction of the damage signal, leading to cell cycle arrest and HR activation. Participates in branch migration and HJ resolution and thus is important for processing HR intermediates late in the DNA repair process; the function may be linked to the CX3 complex. Part of a PALB2-scaffolded HR complex containing BRCA2 and which is thought to play a role in DNA repair by HR. Protects RAD51 from ubiquitin-mediated degradation that is enhanced following DNA damage. Plays a role in regulating mitochondrial DNA copy number under conditions of oxidative stress in the presence of RAD51 and XRCC3. Contributes to DNA cross-link resistance, sister chromatid cohesion and genomic stability. Involved in maintaining centrosome number in mitosis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...