Ackr2 (NM_001276719) Mouse Untagged Clone

CAT#: MC227374

Ackr2 (untagged) - Mouse atypical chemokine receptor 2 (Ackr2), transcript variant 1



  "NM_001276719" in other vectors (1)

CNY 3610.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI464239; Ccbp2; CCR9; CCR10; Cmkbr9; D6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227374 representing NM_001276719
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCACCGTTGCTTCCCCACTGCCTCTCACCACCGTCGGTTCCGAGAACAGCAGCTCCATCTACGACT
ACGACTACTTAGATGATATGACCATCTTGGTTTGCAGGAAGGACGAGGTCCTGTCCTTTGGAAGAGTCTT
TCTGCCGGTCGTCTACAGCCTGATCTTCGTGCTGGGCTTGGCTGGAAACCTCCTCCTCCTGGTGGTGTTG
CTCCACTCTGCACCTCGAAGACGGACGATGGAGCTTTACCTGCTGAACCTGGCCGTCTCCAACCTCTTGT
TTGTAGTGACTATGCCCTTCTGGGCCATCTCTGTGGCCTGGCATTGGGTTTTTGGTAGTTTCCTGTGCAA
GGTGATAAGCACTCTCTACTCTATTAACTTTTACTGTGGTATCTTCTTCATCACCTGCATGAGCCTGGAC
AAATACCTGGAGATTGTCCACGCTCAGCCTCTCCACAGACCGAAGGCCCAGTTCAGGAACCTGCTTCTCA
TTGTCATGGTGTGGATCACATCCCTGGCCATCTCTGTCCCAGAAATGGTCTTTGTGCAGATCCACCAGAC
CTTAGATGGTGTGTGGCACTGCTATGCGGATTTTGGCGGACATGCGACCATTTGGAAGCTGTACCTGCGC
TTCCAGCTGAACCTTCTGGGGTTTCTCCTCCCACTCTTGGCCATGATCTTCTTTTACTCCCGCATCGGTT
GCGTTCTGGTCAGGCTGAGGCCGCCAGGCCAGGGCCGGGCTCTGAGGATGGCCGCGGCCCTGGTGATAGT
TTTCTTCATGCTGTGGTTCCCATATAACCTCACCTTGTTTCTGCACTCGTTGCTGGACCTGCATGTCTTT
GGGAACTGTGAGATCAGCCACCGTCTGGACTATACGTTGCAGGTGACAGAGAGCCTGGCCTTCTCCCACT
GCTGCTTCACCCCGGTCCTCTACGCCTTCTGCAGTCACCGCTTCCGCCGGTACCTGAAGGCATTTCTGTC
TGTGATGTTGAGATGGCACCAGGCACCTGGCACCCCTTCCTCTAACCATTCTGAGAGCAGCAGGGTTACT
GCCCAGGAAGACGTGGTCAGCATGAATGACCTTGGGGAGAGGCAGTCTGAGGACTCCCTTAACAAGGGGG
AGATGGGGAATACTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276719
Insert Size 1137 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276719.1, NP_001263648.1
RefSeq Size 3012 bp
RefSeq ORF 1137 bp
Locus ID 59289
UniProt ID O08707
Gene Summary Atypical chemokine receptor that controls chemokine levels and localization via high-affinity chemokine binding that is uncoupled from classic ligand-driven signal transduction cascades, resulting instead in chemokine sequestration, degradation, or transcytosis. Also known as interceptor (internalizing receptor) or chemokine-scavenging receptor or chemokine decoy receptor. Acts as a receptor for chemokines including CCL2, CCL3, CCL3L1, CCL4, CCL5, CCL7, CCL8, CCL11, CCL13, CCL17, CCL22, CCL23, CCL24, SCYA2/MCP-1, SCY3/MIP-1-alpha, SCYA5/RANTES and SCYA7/MCP-3. Upon active ligand stimulation, activates a beta-arrestin 1 (ARRB1)-dependent, G protein-independent signaling pathway that results in the phosphorylation of the actin-binding protein cofilin (CFL1) through a RAC1-PAK1-LIMK1 signaling pathway. Activation of this pathway results in up-regulation of ACKR2 from endosomal compartment to cell membrane, increasing its efficiency in chemokine uptake and degradation. By scavenging chemokines in tissues, on the surfaces of lymphatic vessels, and in placenta, plays an essential role in the resolution (termination) of the inflammatory response and in the regulation of adaptive immune responses. Plays a major role in the immune silencing of macrophages during the resolution of inflammation. Acts as a regulator of inflammatory leukocyte interactions with lymphatic endothelial cells (LECs) and is required for immature/mature dendritic cells discrimination by LECs.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...