Csnk1e (NM_001289899) Mouse Untagged Clone

CAT#: MC227318

Csnk1e (untagged) - Mouse casein kinase 1, epsilon (Csnk1e), transcript variant 3



  "NM_001289899" in other vectors (1)

CNY 3520.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI426939; AI551861; AW457082; CK1epsilon; CKIe; KC1epsilon; tau
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227318 representing NM_001289899
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTTGCGTGTGGGAAATAAGTATCGCCTGGGCCGAAAGATCGGCAGTGGCTCCTTTGGAGACATCT
ACCTGGGTGCCAACATTGCCTCTGGTGAGGAAGTAGCCATCAAGCTCGAATGTGTGAAGACGAAACATCC
CCAGCTCCACATCGAGAGCAAGTTCTACAAGATGATGCAGGGCGGAGTGGGGATCCCGTCCATCAAGTGG
TGCGGGGCTGAGGGAGACTATAACGTGATGGTCATGGAGCTGCTGGGGCCCAGCCTGGAGGACCTCTTCA
ACTTCTGTTCCCGGAAGTTCAGCCTCAAGACGGTGCTGTTGCTGGCCGACCAGATGATCAGCCGCATCGA
GTACATACACTCCAAGAACTTCATCCACCGGGATGTGAAGCCCGACAACTTCCTCATGGGCCTGGGGAAG
AAAGGCAACCTGGTGTACATCATTGACTTCGGCCTGGCCAAGAAGTACCGCGATGCCCGCACACACCAGC
ATATTCCCTACCGGGAAAACAAGAACCTGACCGGCACTGCCCGCTATGCCTCTATCAACACCCACCTGGG
CATTGAGCAAAGCCGTCGAGATGACCTAGAGAGCTTGGGCTATGTGCTCATGTACTTCAACCTGGGCTCC
CTGCCCTGGCAGGGCCTCAAAGCAGCCACCAAGCGTCAGAAGTACGAGCGGATTAGCGAGAAGAAGATGT
CAACGCCAATCGAGGTCCTCTGCAAAGGCTACCCCTCCGAGTTCTCAACATACCTCAACTTCTGCCGCTC
CCTGCGGTTCGATGATAAGCCTGACTACTCCTACCTGCGCCAGCTCTTCCGAAATCTCTTTCACCGGCAG
GGTTTCTCCTACGACTACGTCTTCGACTGGAACATGCTCAAATTCGGGGCTTCCTCGAGCCAGGCTCAGC
CCCGAGACAACGAAGCTCTTGCGCCACCCTGCCCCCGCCCTTGGCCTTGCGCTGGGCCCGCATACTCACC
CACTTACTGGTGCCCGGCGCCCCTGGGCACCCAAGGACCCCCAGATAGGCCGGTGGAGGAGGAGGTGGAA
CAACTGCCCCCTCAAAGATATTGGCCTGTGGTCTGGACTCCAGGGCCCCAGTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289899
Insert Size 1107 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289899.1, NP_001276828.1
RefSeq Size 3174 bp
RefSeq ORF 1107 bp
Locus ID 27373
Gene Summary The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (3) differs in the 5' UTR and in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...