Camk2d (NM_001293665) Mouse Untagged Clone

CAT#: MC227311

Camk2d (untagged) - Mouse calcium/calmodulin-dependent protein kinase II, delta (Camk2d), transcript variant 6



  "NM_001293665" in other vectors (1)

CNY 3520.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2810011D23Rik; 8030469K03Rik; CaMK II; [d]-CaMKII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227311 representing NM_001293665
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGCATGTGAGCAGCCTGAGAATTTGCTTTTAGCTAGCAAGTCCAAAGGAGCAGCTGTGAAGCTGG
CAGACTTCGGCTTAGCCATAGAAGTTCAAGGCGACCAGCAGGCATGGTTTGGTTTTGCTGGCACACCTGG
GTATCTTTCTCCAGAAGTCCTGCGTAAAGATCCTTATGGAAAACCAGTGGATATGTGGGCATGCGGTGTC
ATCCTCTACATCTTGCTGGTGGGATACCCACCCTTCTGGGATGAAGATCAGCATAGACTGTATCAGCAGA
TCAAGGCCGGAGCTTACGATTTTCCGTCACCAGAATGGGATACAGTGACACCTGAAGCCAAAGACCTCAT
CAACAAAATGCTGACCATCAACCCTGCCAAACGTATCACAGCCTCTGAGGCCCTGAAACACCCATGGATC
TGTCAACGCTCTACTGTTGCCTCCATGATGCACAGGCAGGAGACTGTAGACTGCTTGAAGAAATTTAATG
CTAGACGGAAACTGAAGGGCGCCATCTTGACAACTATGCTGGCTACGAGAAATTTTTCAGCAGCCAAGAG
TTTATTGAAGAAACCAGATGGGGTAAAGGAGTCAACTGAGAGCTCAAACACCACCATTGAGGATGAAGAC
GTGAAAGCACGAAAACAGGAGATCATCAAAGTCACTGAGCAACTGATTGAAGCTATCAACAATGGGGACT
TTGAGGCTTACACAAAAATCTGTGATCCAGGCCTCACTGCCTTTGAACCTGAAGCATTGGGCAACTTAGT
GGAAGGGATGGACTTTCACAGATTCTACTTTGAAAATGCTTTGTCCAAAAGCAATAAACCAATCCACACG
ATCATCCTCAACCCACACGTTCACCTGGTAGGGGATGACGCAGCCTGCATCGCATACATTCGGCTCACAC
AGTACATGGACGGAAGCGGGATGCCAAAGACCATGCAGTCAGAAGAGACGCGCGTGTGGCACCGCCGTGA
TGGGAAGTGGCAGAATGTTCACTTTCACCGTTCGGGGTCCCCCACAGTACCCATCAAGCCACCCTGTATT
CCAAATGGGAAAGAGAACTTCTCAGGAGGCACCTCTTTGTGGCAAAACATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293665
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293665.1, NP_001280594.1
RefSeq Size 5595 bp
RefSeq ORF 1104 bp
Locus ID 108058
Gene Summary Calcium/calmodulin-dependent protein kinase involved in the regulation of Ca(2+) homeostatis and excitation-contraction coupling (ECC) in heart by targeting ion channels, transporters and accessory proteins involved in Ca(2+) influx into the myocyte, Ca(2+) release from the sarcoplasmic reticulum (SR), SR Ca(2+) uptake and Na(+) and K(+) channel transport. Targets also transcription factors and signaling molecules to regulate heart function. In its activated form, is involved in the pathogenesis of dilated cardiomyopathy and heart failure. Contributes to cardiac decompensation and heart failure by regulating SR Ca(2+) release via direct phosphorylation of RYR2 Ca(2+) channel on 'Ser-2808'. In the nucleus, phosphorylates the MEF2 repressor HDAC4, promoting its nuclear export and binding to 14-3-3 protein, and expression of MEF2 and genes involved in the hypertrophic program. Is essential for left ventricular remodeling responses to myocardial infarction. In pathological myocardial remodeling acts downstream of the beta adrenergic receptor signaling cascade to regulate key proteins involved in ECC. Regulates Ca(2+) influx to myocytes by binding and phosphorylating the L-type Ca(2+) channel subunit beta-2 CACNB2. In addition to Ca(2+) channels, can target and regulate the cardiac sarcolemmal Na(+) channel Nav1.5/SCN5A and the K+ channel Kv4.3/KCND3, which contribute to arrhythmogenesis in heart failure. Phosphorylates phospholamban (PLN/PLB), an endogenous inhibitor of SERCA2A/ATP2A2, contributing to the enhancement of SR Ca(2+) uptake that may be important in frequency-dependent acceleration of relaxation (FDAR) and maintenance of contractile function during acidosis. May participate in the modulation of skeletal muscle function in response to exercise, by regulating SR Ca(2+) transport through phosphorylation of PLN/PLB and triadin, a ryanodine receptor-coupling factor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) has multiple differences compared to variant 1. These differences result in a different 5' UTR, cause translation initiation at an alternate start codon and result in a frameshift compared to variant 1. The encoded isoform (6) has distinct N- and C- termini, and is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...