Dpf3 (NM_001267626) Mouse Untagged Clone

CAT#: MC227250

Dpf3 (untagged) - Mouse D4, zinc and double PHD fingers, family 3 (Dpf3), transcript variant 2



  "NM_001267626" in other vectors (1)

CNY 3420.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Dpf3 Antibody - N-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2810403B03Rik; 6530402L11Rik; BAF45C; C78788; cer-d4; CERD4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227250 representing NM_001267626
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACTGTCATTCACAACCCCCTGAAAGCGCTTGGGGACCAGTTCTACAAGGAAGCCATTGAGCACT
GCCGGAGCTACAACTCGAGGCTGTGCGCAGAGCGGAGCGTGCGTCTCCCCTTCCTGGACTCGCAGACTGG
GGTGGCTCAGAACAACTGCTACATCTGGATGGAGAAGAGGCACCGCGGCCCAGGCCTCGCTCCGGGCCAG
TTGTACACATACCCTGCCCGCTGCTGGCGCAAGAAGCGACGATTGCACCCACCAGAGGACCCAAAACTAC
GACTCCTGGAAATCAAACCCGAAGTAGAACTGCCCCTGAAGAAAGATGGATTTACCTCTGAGAGTACCAC
ACTGGAAGCCTTGCTTCGCGGCGAGGGAGTAGAGAAGAAGGTGGATGCCAGAGAAGAGGAAAGCATCCAG
GAGATACAGAGGGTTTTGGAAAATGATGAAAACGTAGAAGAAGGGAATGAAGAGGAGGATTTGGAAGAAG
ATGTTCCCAAGCGCAAGAACAGGACCAGAGGACGGGCTCGCGGCTCTGCAGGCGGAAGGAGGAGGCATGA
TGCCGCCTCTCAGGAAGACCACGACAAACCCTACGTCTGCGACATCTGTGGCAAGCGCTACAAGAACCGG
CCAGGACTCAGCTACCACTACGCTCATACTCACCTGGCCAGCGAGGAGGGAGACGAAGCCCAAGACCAGG
AGACCCGATCCCCACCCAACCACAGAAATGAGAACCACAGACCCCAGAAAGGACCAGACGGGACAGTCAT
TCCTAATAACTACTGTGACTTCTGCTTGGGGGGCTCCAACATGAACAAGAAGAGTGGGAGGCCTGAAGAG
CTGGTGTCCTGTGCAGACTGTGGACGCTCTGCTCATTTGGGAGGAGAAGGCAGGAAGGAGAAGGAGGCAG
CGGCCGCAGCACGTACCACGGAGGACTTATTCGGTTCCACGTCAGAAAGTGACACCTCAACTTTCTACGG
CTTTGATGAGGACGATTTGGAAGAGCCTCGCTCCTGTCGAGGACGCCGCAGTGGCCGGGGTTCACCCACA
GCAGATAAAAAGGGCAGCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001267626
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267626.1, NP_001254555.1
RefSeq Size 1532 bp
RefSeq ORF 1074 bp
Locus ID 70127
Gene Summary Muscle-specific component of the BAF complex, a multiprotein complex involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Specifically binds acetylated lysines on histone 3 and 4 (H3K14ac, H3K9ac, H4K5ac, H4K8ac, H4K12ac, H4K16ac). In the complex, it acts as a tissue-specific anchor between histone acetylations and methylations and chromatin remodeling. It thereby probably plays an essential role in heart and skeletal muscle development (By similarity). Belongs to the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses alternate 3' exon structure and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...