Fst (NM_001301373) Mouse Untagged Clone

CAT#: MC227169

Fst (untagged) - Mouse follistatin (Fst), transcript variant 1



  "NM_001301373" in other vectors (1)

CNY 3330.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AL033346; D2Mgi5; FS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227169 representing NM_001301373
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCTGCGCCAGGCACCAGCCCGGCGGGCTCTGCCTCCTGCTGCTGCTACTCTGCCAGTTCATGGAGG
ACCGCAGCGCCCAGGCTGGGAATTGCTGGCTCCGCCAAGCAAAGAACGGCCGCTGCCAGGTCCTGTATAA
GACAGAACTGAGCAAGGAAGAGTGTTGCAGCACCGGCCGGCTGAGCACCTCATGGACCGAGGAGGATGTG
AACGACAATACTCTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCTTGTAAAGAAA
CGTGTGAGAACGTGGACTGCGGACCTGGGAAAAAATGTCGAATGAACAAGAAGAATAAACCCCGCTGCGT
CTGTGCCCCAGACTGTTCCAACATCACCTGGAAGGGCCCAGTGTGTGGGCTGGATGGGAAAACCTACCGC
AACGAATGTGCACTCCTCAAGGCCAGATGCAAAGAGCAGCCGGAACTAGAAGTACAGTACCAGGGCAAAT
GTAAAAAGACTTGTAGGGATGTTTTTTGTCCAGGCAGCTCCACTTGTGTGGTGGATCAGACCAATAATGC
CTACTGTGTGACCTGTAATCGGATTTGCCCAGAGCCCTCCTCTTCTGAACAGTACCTTTGTGGAAATGAT
GGAGTGACTTACTCCAGCGCCTGCCACCTGAGAAAGGCCACCTGCTTGCTGGGCAGATCCATTGGATTAG
CCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGAAGATATCCAGTGTGGCGGCGGGAAAAAATGCCT
ATGGGATTCCAAGGTTGGCAGAGGTCGCTGCTCTCTCTGCGATGAGCTGTGTCCTGACAGTAAGTCGGAT
GAGCCGGTCTGTGCCAGTGACAATGCCACATACGCCAGCGAGTGTGCCATGAAGGAAGCTGCCTGCTCTT
CTGGCGTGCTTCTTGAAGTGAAGCATTCTGGATCTTGCAACTCCATCTCGGAAGAAACGGAGGAAGAGGA
GGAGGAGGAAGACCAGGACTACAGCTTTCCTATCTCTTCCATTCTAGAGTGGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301373
Insert Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301373.1, NP_001288302.1
RefSeq Size 2575 bp
RefSeq ORF 1035 bp
Locus ID 14313
UniProt ID P47931
Gene Summary The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (1) encodes the longest isoform, FST315 (PMID:17932109).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...