Azin2 (NM_001301841) Mouse Untagged Clone

CAT#: MC227034

Azin2 (untagged) - Mouse antizyme inhibitor 2 (Azin2), transcript variant 2



  "NM_001301841" in other vectors (1)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4933429I20Rik; Ad; Adc; AZ; Azi2; B930082O19; Od; ODC-p; Odcp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227034 representing NM_001301841
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTTGGTCCAGCACATTGGTGTCCCTGCCAGTAAGATCATCTGTGCCAACCCCTGTAAGCAAGTTG
CACAGATCAAGTATGCTGCCAAGCACGGGGTGAGGCTGCTGAGCTTCGACAATGAAGTGGAGCTGGCCAA
GGTGGTCAAGAGCCACCCCAGTGCCAAGATGGTTCTGTGCATTGCTACCCAGGACTCCCACTCTCTGAAT
CACCTGAGCCTGAGGTTTGGGGCGTCGCTGAAATCCTGCAGACATCTGCTCGAGAACGCCAAGAAGAGCC
ACGTGGAGGTGGTGGGTGTGAGTTTTCACATTGGCAGTGGCTGTCCTGACCCTCAGGCCTATGCCCAGTC
CATCGCGGATGCTAGGCTGGTGTTTCAGATGGGCGAGGAGCTGGGCCACACGATGAACATCCTGGACCTT
GGCGGCGGCTTTCCTGGCTTAGAGGGAGCCAAAGTGAGATTTGAAGAGATGGCCTCAGTAATTAACTCAG
CCTTGGACCTGTACTTCCCTGAGGGCTGCGGTGTGGACATCCTTGCTGAGCTGGGACGCTACTACGTGAC
GTCTGCCTTCACTGTGGCTGTCAGCATCGTCGCCAAGAGGGAGGTTCTGGACCAGGCCAGCAGGGAAGAG
CAAACCGGCGCAGCCCCTAAGAGCATCGTGTACTACCTTGATGAGGGCGTTTATGGGGTCTTCAACTCAG
TCCTGTTTGACAACACCTGCCCCACCCCCGCCCTGCAGAAGAAACCATCTGCGGATCAACCACTGTACAG
CAGCAGCCTGTGGGGCCCAGCAGTTGAAGGCTGCGACTGTGTGGCTGAGGGCCTGTGGCTGCCGCAACTA
CAAGTAGGGGACTGGCTGGTCTTTGACAACATGGGTGCTTACACCGTGGACACAAAGTCCCTCCTTGGGG
GGACCCAGGCCCGCAGAGTCACTTATGCCATGTCCCGGCTAGCCTGCTCCTGGAAATATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301841
Insert Size 972 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301841.1, NP_001288770.1
RefSeq Size 1978 bp
RefSeq ORF 972 bp
Locus ID 242669
Gene Summary The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks two consecutive exons in the 5' coding region (which results in translation initiation from an in-frame downstream AUG) and contains a novel 3' terminal exon compared to variant 1. The resulting isoform (2) is shorter with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...