Cops5 (NM_001277101) Mouse Untagged Clone

CAT#: MC226994

Cops5 (untagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5), transcript variant 2



  "NM_001277101" in other vectors (1)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI303502; CSN5; Jab1; Mov34; Sgn5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226994 representing NM_001277101
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGCTGCGCCGCCGCCGCGCCCCAGCGCGCGAATGGTCTGGACCAACGTCACCTCCGGTCTCAAGTG
TCATGGCTGCCTTGAGAGTCTATCACCACTACTTTAAATACTGCAAAATCTCAGCATTGGCTCTACTGAA
AATGGTGATGCATGCCAGGTCAGGAGGCAACTTGGAAGTGATGGGTTTGATGCTCGGGAAAGTCGACGGC
GAGACCATGATCATCATGGACAGTTTCGCTTTGCCTGTAGAGGGCACAGAAACTCGAGTAAATGCTCAAG
CTGCTGCGTATGAGTATATGGCTGCATACATAGAAAATGCCAAACAGGTTGGCCGCCTTGAGAATGCAAT
CGGTTGGTATCATAGCCACCCTGGTTATGGCTGCTGGCTCTCCGGGATTGATGTTAGTACACAGATGCTG
AACCAGCAGTTTCAAGAACCATTTGTAGCAGTGGTGATTGATCCAACCAGAACAATCTCTGCAGGAAAAG
TGAATCTTGGCGCCTTTAGGACATATCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCA
GACTATCCCACTTAATAAAATAGAAGATTTTGGCGTGCACTGCAAACAATATTATGCCTTAGAAGTCTCA
TATTTCAAATCATCTTTGGATCGTAAACTACTTGAGCTTTTGTGGAATAAATACTGGGTGAATACCCTGA
GTTCCTCTAGCTTGCTTACTAATGCAGACTACACCACAGGCCAGGTGTTTGATTTGTCTGAGAAGTTAGA
GCAGTCGGAAGCCCAACTGGGACGTGGCAGTTTCATGTTGGGCTTAGAAACACATGACCGCAAGTCGGAA
GACAAACTTGCCAAAGCTACTAGAGACAGCTGTAAAACCACCATAGAAGCCATCCATGGACTGATGTCTC
AGGTTATTAAGGATAAACTGTTTAATCAGATTAACGTTGCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277101
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001277101.1, NP_001264030.1
RefSeq Size 1482 bp
RefSeq ORF 954 bp
Locus ID 26754
UniProt ID O35864
Gene Summary Probable protease subunit of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of the SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. Promotes the proteasomal degradation of BRSK2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. In the complex, it probably acts as the catalytic center that mediates the cleavage of Nedd8 from cullins. It however has no metalloprotease activity by itself and requires the other subunits of the CSN complex. Interacts directly with a large number of proteins that are regulated by the CSN complex, confirming a key role in the complex.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...